Description :
From Genome Similarity Track
Location :
contig_32:119729- 121126
Sequence
1397 bases(100 bases per row)
TATCATTTGTCCGCTACCATTCCGCGGAATAAAATTGTCGTCGCACGGTCACAAAGGGCTTTCATTCACGATACACTCCTGGCCAAAAGTATACGAACAC
CCCTACTTTTACGAATAACTCGGCTTCTAGCCAGAGTTGAAGGCTGCGCGTTGAATATGTTTTGTGAAATACTGTAAGCGTTTGTTGGTTTGGACTAACG
CTGCGGATTTCAGCTTCTGCTGGGTACCTCACATACAAAAAACCACTTTTGGCTGGTGGCCAAAATATACGAACAGAAAGCACTGAACAACATCCCATAC
AAATTTCTATATTGATGATGGGTGCAGGAATGATGGTAACTAGTAGTGGGCCTTGTTGCCCTTCCTTTCGATGACTTCGATGCACCTGCGAGGCATGGAA
TTGATCAGCGTCGAAATAGTCTCCGCAGATATGTTGTCCCAGGCCGTGTGCAGTGCCTTCGTCAGAGAGGTCACGCTATCGTATTGCCTTCCATTGCTGT
AAACATCCCGGGACATGATTGCCCAGAGGTTTTCGATTGGATTAAGGTCGAGCGATCTTGCAGGCCAATCCATCACTTGCACGCCTTGCTCTTCAAAAAA
GGCTTTCGTCTCCCGCGAGGTGTGTATAGCAGCGTTGTCCTGCTGGAAAACGAAATCTACTCCGTAGTGTAGGTGGGCGAAGGGAAACAAGTATTCTGAC
ACTGTGTAGATATAGTGTTCAGAAGCTTGCCTACCAACGAGCACAGCTAGCTTGGTTTTCCCGGCGGTACTGAAGCCACCCCACACCATCACGGACCCAC
CACCCATTTGCCGCCTGTTTGTTTGGCGGGGAGGCTGGCGCAGATCTCGCCAGTAGTTCTGGAGGCCATCAGGGCCGTCCAGGTTCCACTTCTTCTCGTT
AGAAAAGATGATCTGCGCCCAGTCGTCAGGTAGGATGACCATTGCCTTCGCCCATTTGAGCCTGGCCGCCTTGTGGGCCGCCGAGGGCTGCAGCATATTC
TCCATCTTGGAGTAGACTAGCCAGTCTACTGCCGAGATGGAGCGCCGAACCGTGCGTGTGGAGCAGTCCAGCGACAGCTGGTCCCTTTGCTGGGTCGCCG
AAAGCTCTCCCTTGGCAGCCGTACGAACGAGGCGCCGCAGCGTTCTCTCAGACAGTACTTGAGGCCTCCCTAGCCTTGCTTCTTCTCGTTTAGGGTTCTT
CGAGCGTCGAATAACGCGCAGAACAGCTGGTGCGTCTTGCCGGCGATGGCGCGAACTCCGACTCCAGCTTCGTGCAGCCCTTGGATTCTTCCCTTCTCTT
CGTCAGTCAGCAGCTTGCCCTTGCCCATCAATTCGAGAAATGAGCGCAACGAGCGGTGCCCCCTGCGTCCCAGCATGCGACCATCACGGGCCTTTCA