Description :
From Genome Similarity Track
Location :
contig_95:11972- 17285
Transcript NameFunction/comments
g13319.t1hypothetical protein

Sequence
5313 bases(100 bases per row)
CTTGCTCGTCCCACCGTTCCCCGCGCTATCTGGATCCCTGGATGTTGTGCTCGTTCTCGTAGGGCGGCAGCGGACGTTCGCCCGTGGTCGGCGAGCACTC
TGAGCCGGGTCAGTGTCTTGGAGATGGACATCGAGTTGCTCTTTCATCACCTGGCAAAGTCTAAAAACTGGCTTTTTCCGCCGCAGAGTCGATCGCCTCG
TCGCGGCGCTTGGTCACATGGTCTGATCACCGAAAGCAACATTGCGGCACTTTACGCGACGACGCCGTGGAATTCTCTCAACGTCTTGGTGACGCCTTTA
TCTTTTGAGGTGACTGGTTGGTTCGAGGCGATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGGGAGGCTACGCACGCGTTCA
TGATCAGCTCCGCGCTTCGTAAATCGAACGCATATCTGGCGCGTCTTTGGGAAGATCGTAAGCAGAGACGATCCCGCTTCGGTGCCGTCTGGAAACGCTT
CCTCAAGTTCATCTTGCAAGGGATGATTGCAGGGCACTGCGATTGGATATTCTGCTGGACCCTTTCTTTCTGCATTATCCCCGGGCGCACGAACAACGGT
TTGGTACCCTGGACTTGGCTGCAGCTCTCCGCCCCAACCTGGTGGACGTCCTACGTGCCGTCGATCTGGTTGACCCGTGGCGCAATCAGTATCGCGGCCA
CCTTCAAGATCATCCGGTCTCCCAACTGCCCCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAATGAGGTAGTTAGTAGATCGTATATCTTCTCAAT
ATGATCCTCACGGCTTCTCCCTTTGTTGTTCTGCTTCATCATATTCTTGCTTATCGAGCATCCCGCTCCGATCGAGAACAGTCGTCCTCGATCTACACAA
CAATATCACATAAAACCCTTCCACCTCAATGTGCGACCACCTCGCACACTATTCACACCACTCCTCCGCTCACAACAGCCAACCTGCTACGAGCTCTCCT
CCCCTGCCTCGTCATAGCGAAGCGATTCCGGTTGGTGACTCCTCGCTCGTACTCGCGCAACAAGGCTCCGCAATTCAGATCGGCTTCATCAACCCACGAA
AGCTGATCGTAACCCTTCCAGCGCACCTGAAATTCTCGATGGACGCGACCATACCGCGTACGTCGACCTGATCGCATATTCACGATCTTCTCCACCTCGA
ACTCGTCTTCATCTAAACCGCCTTCCCAGCTGTCTTCGGGTAAAAGTGCCTCATCAAAGTCGAAGCGATCGTCTTCGTCCACCACCAGCGTCAGCGTGGG
GCGATCGGGGAACGATCGCACAGGCTTGAGTTTTGACACATGGACGATCGGGAATAACCGATAGTTGGTGCCAGCGACTTCCAACCTTGCTGCATGATTG
TCAAGCATCTCGATCACCCTGAACGGTCCGTGCCCCATGTGGGCTAACTTGCGTGCATAGACCTCCTTCACGCGATCTAGGTGCAGCCACACTTGCATAT
TGGCCTCAATCCCATGAGGTCGGACCTGATCGTTATGCCCGTCTGCTCGTCCTTGGATGGCCTCCCACAGGGACTCATTAACCTCTTCTCTGGCTCGACG
ATAGTGGCTCTGTATATGATATCTCCACCGACGAGGGTCACGATCCCACCGGCGCGTGCTTCCGAGAGGTAGCGACGCTTCTAACGTAGATTGCGGGTCC
CACCCGTGTGTCAAGTAGAACGGCGTATCTCCTCGAACCCGATCTTGGGCCGTGTTGAGCGCGAACGTCAGTCACTCCGCGTACTCATCCCAGTCCTGTT
GGTTGACGTCTGCGACATACCTCTTCAGCGCACGTGTCAATGTTTGCACCATCCGTTCTGCCGTCCCATTGGCCTGTGGACGATAAGCCATAGTGGCCCT
CTGTTTCTGTCCCACTATCCTGCTAAAAGCACGGAAAAAATCAGACACGAACCCAGGTTCCCTGTCGTGCCGGATAGCCTCACTGGCTCCAAAACGCCGG
AAGACGCATTCCTCGTAGTTCTCCGCAATCGTCTGCGCTGTTCTTGACGTGCTCGCTTTAGCGATCACATAACCCGAGAACAGGTCTACCCAGATCAACA
GCTCCGTATTGCCTTCGAAGGACTTGGGCAACGACGGAATGTGATCCATAGCGATGATCTGAAACGGGTACGTCGCTTGCACGTTCCCAGGGGATTCTCC
TCTCACGAAGGGTCGGCCTTTCCCTGTCTCACAATCTGTACATTCTCCCACATAGCGCTGAACTCTTCGGTATAAGCCCCTCTAGTGGAAGTGTGATCGG
ATTCGTCGGTACGTCCTTCCGATTCCTTGATGTCCCCCCTTCCAGACTTGCGTGGTAATGATGTAGAAGATCTTGTTGCAGGGTCTCAGGCACCACCAGC
TTCGCGATCACGTCTCGGTCCTCATCCTGCCGCATGGCTGACGGGCAATAGAACAGCAGGTCGTTTTCGTCCAACTCGTTGTCGTTTGCGACCTTGGCGC
ACGATTTAGCTTCGGCTGCGGTTAGAGCCTCGACGTTCCCTTTCAGGTACGCTTTCAGATCGATGATCCACTTCTTTTCGTTCTGTGCTTGGATGATTCG
CTCACCGCGTATGCGCTGTACAATTGCTTCTTGCAGGACTTCAGGAGTCAGTCGTCAGCGTCGCGTTGACCTGGTCACAGCAGACACACGGACGACGGCA
TCGTCGTCCCTCGTCTTGAGGAGATCGTCCAAACGGTTGAGCGTGATCAAGTCTTGTTGATCCTCGTTTGAGGTGACTACGACCCCTTCGCCCCGTTGGA
GAGCTTCACTGGCTAGCTTGTCTGCACTCTGGTTCCAATCTCGTTTCATGTGTAGGAACTCGTGTTTTGACCACGATCTAAGTTGATCCATCGCCTTCTG
ACTCAACAACAACAGACCAGAAGCTTTGCACGCGATCTCACCACGCATCTGGCGGATTACCAGATTAGAGTCGCCGCAGATCACAATCCGCCCCCTGTCC
ATGGTGGACAGCAGATCGAAGCATAACAACAACCCGCGGTACTCAGCCTCGTTCACAGTCAGATCGGGCATATATTCTGATGCGGCGGTTACGATCGTCC
ACTCTGGCAACTTCCATATGATCGCACTGTAAGCTCCACCACTGCGTTTGACACGTGCCGATCCATCGAAACTTGCGATCAACAAAGTTTCGTCCGCTTC
GAACGTAGTTGGTGGCATGGTAATCGTCTGTCGGGGCTGCTTCACGGGTGCAATCACGATCAACGCCTCGTCTACTTCCGCTTGAGGTGTGATGCTTGCT
GCCATCGTGCCTAAGATTTCGTCTTCCCCTTTCGTGCACTTCCTGATCTCCAGTGTCCACTCTGATAGCAAGGCTGCCCAATTGCCAAGTCTCCCCTGGA
GACTGGCTGAATTGACTAACCAAGCCAGCGTCGAATGCCTGGACAGCACCAAGATCGATCCCGTCGTCAGCAAGGTGTAATTCACGTCCAGCATCCGCAA
GAGTGCCAAGACTTCTTTGTCGACAATCCCGTAGTTGATCTCGTTAGGTTTCAGAGTACGACTGGTGAAGGTTACGGCCAGTACACGCCATCATGTTCAT
GCACAAGAGCTGCGGAGATCGCCCACTGACTCGCGTAAACTACGATCACCGGAGTGCGATCTGCGTCGAAATGCTTCAGGATCGGGGTGGACACGATCCT
GGCTTTCAGCATCGTGAACGCGATCTTCGCTCGGGCCCAGCGGTCAGCGTCTTCCGCTCGCGGGACATCGCCCCCAGCTACTTGTTCGCTGAGGATGGAT
CTGTCCTGTCGGGCAATCTCGTGGAAATCCGTTTCGCGCAGCTCGTACAATACAGCGGCATAGATCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCA
AACTTCCAAGGAAGGACTGCATCGATCGCAGGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGGTTTTTCGGATGGGCTTCCAAACCGTCGGCGGAT
ACCTGATGTCCCAGGTAGTCTACCTTTCGTCGGCCCCAGAAACTCTTGACCACGCTGATAGACAAATTCTATCGCTCGCATGCGTCGAGCAGCGCCTCTA
CCTTTTCGCACAGCAAGTCCCAAGTGATCGCGGTCACCAGAATATCATCGATGTACGATCGCCTTCTCAACACTGACGGTTTCGGCTCTAGTTCCGGCTC
GCCTGACTCGAACACGTCGATCGGTTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTATCGATCAACCACTGGTAGATCTGT
GGCGCATTCTTCAGCCCGAAAGGCATACGCGTCCACTCGAACAATCCGAGTGGCGTGATAAAAGCGGAGATCTTCCGTGCGCGCTCCGTCATGGAGACTA
CCCAGAAGTCACTCGTCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAATTCTTCCAAGAGATCGCTAATCAGCGGCATGGGATACACCATCAGTCT
CGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAAAGTCCACGGTGAAGTCGA
CGGCGTGATCGTCTTTGCCGATAACAGACTCTTGATCAGATCTGACAACTTCTCGCGGAACTGTGGAGCGACTTTTCGGACGCGTTGTGGAACGGGCGCC
GGCCGCTCCTCCCACATCGATGTCGCAGACTGCGCCGACGACTGCCGGTGGTAGCGTGTTCCCTTTCCCGATCAGGAGATGTTTCCGTCTCCAAATTATC
TGTCGCAGCTGATCGATTTCTTCCGGAGTGTTCGACTCTGGATCGCCCACCTGGATATCCTGGATCGTGACCTCATCGGTGGCGGTCACTACCTCTGGCA
GAATTGCCATCTGTCGTTCTACATCTTCGGCGAAGAGATCGCCACCTTCGTGGTAACATACTTCCTCGTCGTCGGGTAGTCGCGTTTCGTTCCTGGGCGA
AGGCTCCTCCTGATCTCTCGGGGATCTTTCGGTTTCTGGTCTCATCTTAGCGGGTTGGGGCGCGGCTAGTTGTGCGACGATCAACTTCGGGGCTCTACGA
TCGCGACGCAAGACTTCTGTCGGTGTGTCGTACCGGGGCCGATCTACCATGGGTCCGATAGGAGCGATCTTAGGTTCCTCCGCACCCACACGGTCTGTGG
TGGACTGGAACGCCAAATTCTGCCACTCGGCATACCGACGCGATCCAACTAATATGAACCCAGGGATGCGAGGTACGCATCCTCCTTCAAGCCACATGCC
GATGTGGATATCA