Description :
From Genome Similarity Track
Location :
Scaffold_5:11972- 13030
Transcript NameFunction/comments
g2720.t1hypothetical protein

Sequence
1058 bases(100 bases per row)
ACGTTGGAGCAAAACTCGGGCGGTGCGTCGGCTGCGGGCGGTCTACGTGAGGATGGCAGCGGTACCACGCGGTAGTCGGCCGACTCCTCGCGCTTGTTGG
TGGCCGACGGGTCGGGGCCTCCACGAAGCGCCATGTTGCGCGTGTCGGAGTTGACCGTGTTGGCGCCGCTGGCGAGTGTGTTGCCCGTCGTGTGGAAGGA
GCCGGCGCTGGCGGCCAAGGAGCTGGCAGGCGCGCGCGACGTCTGCAGCTGGTGATACGCGTCCTGGTGCTGGGAGGCGCCCGCGTCCATGAGCTGCGGA
GGCGGATGCGGAAGCTCGGCGCTTCTTCTCTGCCTTAAAGCTATATGCAGTGGCTTACGGCGAAACGTAAGGGGGATCTGGCTCGATTAGGAACATGCCG
CTGGGTGGGTCGGGCGTGGCTTGGAATGTGGTACACCTAGTATGAGGTAAGATGAGTGTATGATGTAGTATGGCTCAGTTTGATGCCACTGCACAGGTCT
CTAATCGGGATCCACTATGCAGCCACTTCAGCCGAGTATCCACCAGCTCTGGCGGCCAGTATTTGTAGGGCTTGTTTTGCGAATTGCTGCCTCATCTGGG
ACAGCACCTTGCTGCGCGAATTACGCAGCGCAATATCCAGCAGACCAGAGGAGCCTGCAGCAGGCACCTGATCACTCCACACCTGCAGCAGCCGGAACAC
ATCGCGTGAACATGCGTGGACATGATTTGGGGATCGCGTGGCAATTTGCCAGCAAACAACACGGAGAGACCTCGTGAAGTTGCTCCTAACTCGGCTGGTT
CGGCGCAACGGACACGTGAGTGTGCCTACGCTGTACATGTAGTAATGTATCTGCGTACGAGTCGTAGCCGACGACAGCTCGATGTGCAGTTCCGATCTCC
AAATCGCTGAGATGTAGGATACCCGCTGCATTGGAGCATTGTGTGGTCGTTCAGCTGATGCTCGGACCTACACAGCTTCACGCTCGGCTGGCAGAAGTCT
TCAATGCGGCCCAAAACCACGGCTAAGCTTACTACAAGACGCGCCCGACTACGGAGGT