Description :
From Genome Similarity Track
Location :
Scaffold_1570:1197- 4142
Sequence
2945 bases(100 bases per row)
TGGTAGTGGGATCCGGGAAAAGGACAGTCCGGGTGATGGCCGTCACTAGGTCCAGAGGTAGGATTGGATCCAGCCCCCAAATTCTCGAGGAAACATTTGT
GAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGTGTGGATCCTAGGACTAAAGAAGTATCTGATGGAGGATGTACGAGACCTGAGT
CGGGAAGATGCCAAATCCTACAGCATTATCACTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCTCTACGAAGAGAGTCAACGAGG
ATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTACCACGCTAGCTTGGAAGGCGGACATCAGGGCATTGG
TCGGACCTACCAACGGATCCGGGAATGTTTTCACTGTAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAG
GGTAGGCCCACAATCGAAGGGGGGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGT
TCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGATAGCCAAAGCTAGTACGTCTAGAACTGCGCAGACCATTGCTGAATC
GTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGG
ATCCTGGGGCAGCGACAGCGAGCAACTATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAACGCATGGTGCAGACGATCACGAGAGCACTCAAGATGT
ATGTCCAGGATTTGGATCAGAAGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATT
ATACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCGGTATGTAGCACCAAAAAGAGAAACCGAGATCCAAGACGATGGCGATAC
CAGGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAAGATCGAGCGGATCGACACAACGAAGGCGCCCGTC
CACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGGTACGCCCGAAAATTAGCCCATTTATGGCATGGACCGTTCC
GGGTGAGCGAGAAGATAGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGT
CAAAGAATATCCGGATCGGCCGCAGATCCGCCTTTCGGTGGATGAATCCGACCGGGTGGACTTCGACGAAGTCCTCCTACGGGAAGATAGTTGGGATATG
TGATTCTCGAAGACCGACGAGTTTCGAAGTCGAGAAGATCACCGAATATGAGTTCGGGAAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGT
GTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGGGATCGTACGAATCGTAAC
AGATTCGGCGTGATGCAGTCTCATGAAGAAGAATAGGAAGGGGATCCATGGATGTGAGTCGGTCATGTCGATGGGAGGATGAAGAAGGACCCACAGGAGG
GGTGTGGGCCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGGAAAGAAACAGAAGACGAATCCACAGGGTGGATTAGGAGGAAGGAGTGAATG
TTTATGCATAAGAGTGACGTTTTACGTGCGAGGAGTCCTGTTTGATCTCAAGCACGAGCTTTCAAGGGCCCCAACTATACTGACCCAATTGATCCTGGGT
CATTGGCGCTAGATCCGGATGAAATCCAGGCGCAGATCCAACCGGATCCGGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGA
TTCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAGGGGTGGATCCCGCCCAGATCCAGGTTTACACTGAAAGGGTGGATCC
CGTCCAGATCCAGGTGTACACTGAAAGGCCCGGACTAGATTTCTCAACCAACGAGGGAATGTTATAGACATATTCAAGTAAGAGAGTGTGGATTATAATA
GCTTATGCAAAGGGCTAGCTCGACCCAGTTTCCAGTCGCTAGTTACTGCTACGAAACGAATCCACGAAGACTGAAACTAGGGGCGTGGCGTCAAAGAGTG
ATGAGGATCAGGTAGTCTTGGGCTGAACGTTGAAGAACTTGCCCACTAGACGCTGGATCTGGCGTACTGGGTGTTGGCTCAAGTCCCCGCGAAATGTGGT
TACGCCAAGGCTCGGCTTCGTCGATCTCTCGCAAGGCTTCCAATAGGCTCGTGGGTTCTGGGCGATGGAGGTTGGGATCCTCCAAGTTGGCTTGACGGGA
TACGGATCCCGGAAACCAAGCTACCTTATCCCCGCGTCGCGGAAGATGCAAGAAGGATGGATCCAGCAGAATATCCACGTCACACCAACTGTCCTGGATT
GCCAACACGAGGATCACAAGGACTCTCTTCCAAGCTCGGCCAGCATGGCTACGTCGGTTACCACGCTGCTTGTTGAAGTTGGACAACCAAGTCGAACCCT
GCAGTTGATTCCGAGAGATGGAGAACCGGTGAGTGCCCTCCCATATAGCAACTCGGTGCTTGGAGGCGAAATCCCGGAACGCACGAACAAATACCCCGAG
TCGCCCACGCACATCACCCCTGAAGCTAACCGGATCCACCGGTGT