Description :
From Genome Similarity Track
Location :
Scaffold_399:1197- 2862
Sequence
1665 bases(100 bases per row)
CTTCCTCCTAATCCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCCTCCTCCTGGCCCACACCCT
TCCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGT
TACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACAC
TAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTTCGAGCTCGTCGTCTTCGAGATCCACATTC
CAACTATCTTCCGGTAGGAGGACTTTGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCCGATCCGGGTATTCTTTGACCAACT
TCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTATCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGG
TCCATGTCATAGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATAAAGTCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCG
TCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGACGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGAATTTCTGGACTTGGTATCGCC
ATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGT
ATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTG
AGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGATCCGTTAGCTTGGGGGCGATATACCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGA
AAGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGC
AATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTTCTTTGAACGACTTG
GGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAAGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTG
TCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACC
CTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTG
ACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATGCACTGCGTAATCCGTAGCGAT