Description :
From Genome Similarity Track
Location :
Scaffold_1128:1197- 2225
Transcript NameFunction/comments
g14163.t1hypothetical protein

Sequence
1028 bases(100 bases per row)
GTGTACACTCCGTCTTGTTCCTACCGTTCTGGAATAACTCGAACGCAATGCCTTGCATCTCGATCTCGACGTAACCCTTGACATGGCCACATACAGCTGA
CCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTACCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAA
ACTGCCTGCGTCTTAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCGTGCCTGTCGCCGGC
CATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATG
ATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTCGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCAT
CCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAG
GATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAGTAGCT
CCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGTGGAATCTTGATGTAGTCATTTCCCAGATCATTGTGTA
CCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTC
TGTCAGACGCACCTTCTGGAAAGTGGCCACAGTCCGGAAGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACCGGGAGAATTT
GCCTGGAATCTCTCTGAAACTCGACCAC