Description :
From Genome Similarity Track
Location :
Scaffold_62:11969- 13128
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_62-abinit-gene-0.33Novel protein

Sequence
1159 bases(100 bases per row)
CTCACCTTGAGCGATTCTTCCAGTAGCGTGCAGAGAGCAGTGAGGATCGGCAGCGGTGTCGTCGTCGAGTTAGCTGTCTCATGGAAGCGACAAGTCAGCC
ATTCGAGGAACGCACACTTGCCAAGGAGATAGTGCGCGCCAGCCTCAGTCTTGAGCATGGCCACGAGGATACTGCACACCAGTAACTGTGTGTGGTCATC
GGCCAGATCCGAGCCAAAGAAGCTCAGCAGGATGGACGGCACGTGGCGGCGGATGAGCAGCGAGACGTCAGCGTCTTCGCGAACACCTCGACGCAGTCCG
TGCAGCAGCCACGACCGCTCCTGCTTGTACGTCTGCGGCGAGTGGCTGTTGAAAAGCGAGTAGAACATCGGCACGTCGCTGAGATCGAACGCCGGTCGCG
CGAGAAGAAAGTGGTTCACGTGTGGATACATTGTGTGCCCTGGACGCCCAAGAATCGAGATCGCATCGTTCATAAACACTGTGATAGCAGACGAGACACC
CTCGAGTGGCTCTTGCAATGCATTGCGAAGCATGTCCAGCATGAGATGCACCTGGCGTCCGGGTTTGAAATCGGTTGCGGCATCTGCGCTGAGCGACTCG
TGGACGTGGGCTAAAATGGCGTACGCATACTCGCGGACGTCATCGGCGTTGGACGACACGGCACGGAGTGCGACGCCGACGACACCTTGCTGTACTATCG
CGGCTTCCGGGAGTGCCGACGACGCCACGTACCGAGCGAGCATGGGTAGCAAATACGATGGATCGTACACGATTGCTCGCGACGACTCGTCGACATCACC
ACAGTTGTCTTCGAAATCATCGTTGAGGGCCACGTCGTCCAGGATCAAAGCAGCATCATTCTTGACGGAAATCCCCCGGTACAAGGGGAACCATTCAATG
GTCGCACGGATTCGCGTCGGCTCAAGTCCGCCGCTAAAGAGCCACGCCGAATCTTCGATCAGATCGCTGCGCACGCTGCCGTCTTGCTTCTGGGACTGCA
TTGCCACGCAGGATGAACCAAAGCGGTACCCGTAATGGGACGCGAAGATGCCCGCCTTTGCCTCAAACTCATCCAGGAGCGATCGAATCATGCGGTCCGG
CAACGACAAAGAGACATCGTACGCGCCTAGGAGTTGGTAGAAGAGTGTATGCGTGTACA