Description :
From Genome Similarity Track
Location :
Scaffold_15:119658- 120688
Transcript NameFunction/comments
Phymu_g1089hypothetical protein PHYSODRAFT_509738

Sequence
1030 bases(100 bases per row)
AGCGTCGACTGCGCAAGATGAGCGAAGAGTTCCAACcgtccagcttcaccttcgcAGTGCAAGCGCGTCTGCTCTGTGTGGGCATGTCGGTGGTTTACCG
GGTGTCGCTCTCCTTGGCcatcaccagcacctgcacgaCGAACGGCTCGACGACATCGAACGGCGGCCACGCGACACAATCGGCGTGGGTTATCGCAATG
AGCCAGACCAAATTCCGTGGATTTTACGCTCAAGCGAACTCCATCTTGCACCATCCAACCGTAACGCAACACCTCGGTCCGGCAATACAACAGGATGGCA
ACCTTGTCGTCGAATGGAAACCCTTCGAAGTGTTTGTACGAATTCTAACCGAAGTGTTCCAGCGGTACGAGCACCTGCAGTATGCAGCCTTCTGTATCCA
AGCAGACGCTAGCACCATGAATGCAGGGAAGGTGGAGCTCGAGGGGTTTCTCTTGGACTGCTGGAAAGCATTGAAAGTAATCGTCCCCGCGCTTGTGGTG
GAGCCGTATCTACCAGCTCCTTTGGGGCGTGAGGTGCTCTGTATCTACTTGCTAATGCGTGATTTCCTCTCGCTCCCCGAGAgtgtgctggacgccaatt
GCACATACGCGAACGCCATCCTCAGcctcgaagatgtcgaagATTTACTGCCCATTCACTCCGAGTACTCGTGCAGTATTTGCCTCGAGGCGCTGGTCTC
CAGTGAACTGAAGGGCTTTGAGCTCCCCGAAAGCGACCGTGTCAATAGCAGCAGTGatgccagcagcaacaacagcgacagtgaagacgtAGTGTTGGCA
ACTGCCGACGTGACCAACAACTTCTCTGTCAAGTTACCCTGCGCACACATCTACCATGAAAATTGTATTATGTCGTGGCTGCGTCACAACCCCAGCTGCC
CCGAGTGCCGCGCTCCTGTCGGTGCAGGCCACCTGTAGCAGTACGGACAAAATACCCATAGAGAAAAGTGCAACACACTCAACTGCGAATAGAGACATAG
CGTCATGAATCGTGAAGATATACTTTTCAC