Description :
From Genome Similarity Track
Location :
Scaffold_32:119612- 121200
Sequence
1588 bases(100 bases per row)
TCTCACAAATAAGTGCCACACCAAGGCCGCGTTATGTCAAGGGGCAGTGCACGCTGTCTGCTGCAGCACCTATTACATAACAGGGATTGCGTATATTACC
ACCCGTTAAAGAACTGTTTGGAATAGGGTACTGAAACCAAGGTTACATCGTTGGTGTTATTTGTGTCGATAGAGACCTATGCAAACGAGCACTCGGCGAA
ATCAAATCATTAGCTTCAAACCGACCTTTCGTGAAGTACAAGAAAAAAACTCAATTCATTGCATAGGCAAACATCAATAGTTGAACTAGGTGCTGCCGTA
TAATAAGTCCGTTCGTGCAGTGACCTGGTTGTCGCCGTAATACCAATGTGAGAAATACCCAAAGGTTCATGGCATGTATTGAAGTTGTTCGCTGGCGGTT
GGGACAAAGCCGTGCACAAGGCGTTTCCGTCGAATGAGATAGGTTGCGCTCATGTCATAACGGGTACGGAGCAGGCACCCGTCATTGTCGCTCTTATGGA
TAACACCTTTTTCACGTATGTGGATGCTTTGGTGGTACATTCTAGGAATCCAAACCTCAAACATTGTGTCTGAATCATGGCAAAATGATCATAGTGGGGG
GAAATCTAGAGCACGCTGGGGCAGAGTACGAGAGTATTAACGTGCGCTTGCACTGTTACATACAGGTAAACGGCATTCGACAGACCAAAAATACAACGAA
AGTGTAGTGTTCAACACCTACATGTGTAACGAGTGCAACAATCTCGCGATTTAGCCAATCATTGTCGTACGTTGGAAGCTCCACATAAAAGTCCTCTGTG
TTCTAAATCGTTTCAGAAGGCAAACACTCTGCACCATCATAATCGCCGGAGTCATGCTCAGGAATGCAAACCATTGAAGGAAATACGAGTAAACAGAGCG
ACGGACAGTACGACATACAGCAATGGGGGCGATGTTCGCGGCAGCGGTAAAGAAGAGAGTGGGGCAGGAGAGCAAAATTGGGGGTGGAAAGAAGAACAAA
AAGGATAACGAGGAGGATAGCGATGAATAAAGTAATGAAGATATAGAGCGCACCGCGGAAATGGACAATGAGGAGGATAGCAAAACCTGAGATATTTGAG
TACAGCGCTGGACCCTCGCGATCTGATCTTGTGGTTGCTCAGATTAACCATTGCCTCCTCCTCCACCCGCTTTCCAAGCTCGATCGTCTGGTCACGATAA
CCGACACCGGTGGGTGTCCAGCACGAAGCCGTCGGTCAACAAGAGCGTCATAAAGGCCACCAGCAGCTTGGCCTTCGACCTCTGGCGCTTCGGCTCACCT
TCCTGCCAGCGTGGGTCGTGTGCGTACCACGAGCATCAGACAACATGAAGGTGAGTGACTGCAGCCCTGCGTTGATTCTTCATTGGAGTGCTGGTGTTTT
GTGCTTCTTGTGTATCTTCTGGATCGTCGCATTTGTTTGTAGTCACCAGGTCGTTATCCTGCTTGACCTTTAGTGCGTCCATTTCGTGTCTCCTGTCGCT
TGAATAGCGCGATTAAGTGCTCAATCATAGCCGCTTGGTGATCGCTGATCTGTTCTTCCTGCTGAGGTTTTGGATGATTGCTACGTCT