Description :
From Genome Similarity Track
Location :
contig_95:11961- 17285
Transcript NameFunction/comments
g12797.t1hypothetical protein

Sequence
5324 bases(100 bases per row)
GCAGGTTGCTCTGGATCAGCTTGCTCGTCCCACCGTTCCCCGCGCTATCTGGATCCCTGGATGTTGTGCTCGTTCTCGTAGGGCGGCAGCGGACGTTCGC
CCGTGGTCGGCGAGCACTCTGAGCTGGGTCAGTGTCTTGGAGATGGACATCGAGTTGCTCTTTCATCACCTGGCAAAGTCTAAAAGCTGGCTTTTTCCGC
CGCAGAGTCGATCGCCTCGTCGCGGCGCTTGGTCACATGGTCTGATCACCGAAAGCAACATTGCGGCACTTTACGCGACGACGCCGTGGAATTCTCTCAA
CGTCTTGGTGACGCCTTTATCTTTTGAGGTGACTGGTTGGTTCGAGGCGATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGG
GAGGCTACGCACGCGTTCATGATCAGCTCAGCGCTTCGTAAATCGAACGCATATCTGGCGCGTCTTTGGGAAGATCGTAAGCAGAGACGATTCCGCTTCG
GTGCCGTCTGGAAACGCTTCCTCAAGTTCATCTTGCAAGGGATGATTGCAGGGCACTGTGACTTGGATATTCTGCTGGACCCTTTCTTTCTGCATTATCC
CCGGGCGCACGAACAACGGTTTGGTACCCTGGACTTGGCTGCAGCTCTCCGCCCCAACCTGGTGGACGTCCTACGTGCCGTCGATCTGGTTGACCCGTGG
CGCAATCAGTATCGCGGCCACCTTCAAGATCATCCGGTCTCCCAACTGCCCCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAATGAGGTAGTTAGT
AGATCGTATATCTTCTCAATATGATCCTCACGGCTTCTCCCTTTGTTGTTCTGCTTCATCATTTTCTTGCTTATCGAGCATCCCGCTCCGATCGAGAACA
GTCGTCCTCGATCTACACAACAATATCACATAAAACCCTTCCACCTCAATGTGCGACCACCTCGCACACTATTCACACCACTCCTCCGCTCACAACAGCC
AACCTGCTACGAGCTCTCCTCCCCTGCCTCGTCATAGCGAAGCGATTCCGGTTGGTGACTCCTCGCTCGTACTCGCGCAACAAGGCTCCGCAATTCAGAT
CGGCTTCATCAACCCACGAAAGCTGATCGTAACCCTTCCAGCGCACCTGAAATTCTCGATGGACGCGACCATACCGCGTACGTCGACCTGATCGCATATT
CACGATCTTCTCCACCTCGAACTCGTCCTCATCTAAACCGCCTTCCCAGCTGTCTTCGGGTAAAAGTGCCTCATCAAAGTCGAAGCGATCGTCTTCGTCC
ACCACCAGCGTCAGCGTGGGGCGATCGGGGAACGATCGCACAGGCTTGAGTTTTGACACATGGACGATCGGGAATAACCGATAGTTGGTGCCAGCGACTT
CCAACCTTGCTGCATGATTGTCAAGCATCTCGATCACCCTGAACGGTCCGTGCCACATGTGGGCTAACTTGCGTGCATAGACCTCCTTCACGCGATCTAG
GTGCAGCCACACTTGCATATTGGCCTCAATCCCATGAGGTCGGACCTGATCGTTATGCCCGTCTGCTCGTCCTTGGATGGCCTCCCGCAGGGACTCATTA
ACCTCTTCTCTGGCTCGACGATAGTGGCTCTGTATATGATATCTCCACCGACGAGGGTCACGATCCCACCGGCGCGTGCTTCCGAGAGGTAGCGACGCTT
CTAACGTAGATTGCGGGTCCCACCCGTGTGTCAAGTAGAACGGCGTATCTCCTCGAACCCGATCTTGGGCCGTGTTGAGCGCGAACGTCAGTCACTCCGC
GTACTCATCCCAGTCCTGTTGGTTGACGTCTGCGACATACCTCTTCAGCGCACGTGTCAATGTTTGCACCATCCGTTCTGCCGTCCCATTGGCCTGTGGA
CGATAAGCCATAGTGGCCCTCTGTTTCTGTCCCACTATCCTGCTAAAAGCACGGAAAAAATCAGACATGAACCCAGGTTCACTGTCGTGCCGGATAGCCT
CACTGGCTCCAAAACGCCGGAAGACGCATTCCTCGTAGTTCTCCGCAATCGTCTGCGCTGTTCTTGACGTGCTCGCTTTAGCGATCACATAACCCGAGAA
CAGGTCTACCCAGATCAACAGCTCCGTATTGCCTTCGAAGGACTTGGGCAACGACGGAATGTGATCCATAGCGATGATCTGAAACGGGTACGTCGCTTGC
ACGCTCCCAGGGGATTCTCCCCTCACGAAGGGTCGGCCTTTCCCTGTCTCACAATCTGTACATTCTCCCACATAGCGCTGAACTCTTCGGTATAAGCCCC
TCTAGTGGAAGTGTGATCGGATTCGTCGGTACGTCCTTCCGATTCCTTGATGTCCCCCTTCCAGACTTGCGTGGTAATGATGTAGAAGATCTTGTTGCAG
GGTCTCAGGCACCACCAGCTTCGCGATCACGTCTCGGTCCTCATCCTGCCGCATGGCTGACGGGCAATAGAACAGCAGGTCGTTTTCGTCCAACTCGTTG
TCGTTTGCGACCTTGGCGCACGATTTAGCTTCGGCTGCGGTTAGAGCCTCGACGTTCCCTTTCAGGTACGCTTTCAGATCGATGATCCACTTCTTTTCGT
TCTGTGCTTGGATGATTCGCTCACCGCGTATGCGCTGTACAATTGCTTCTTGCAGGACTTCAGGAGTCAGTCGTCAGCGTCGCGTTGACCTGGTCACAGC
AGACACACGGACGACGGCATCGTCGTCCCTCGTCTTGAGGAGATCGTCCAAACGGTTGAGCGTGATCAAGTCTTGTTGATCCTCGTTTGAGGTGACTACG
ACCCCTTCGCCCCGTTGGAGAGCTTCACTGGCTAGCTTGTCTGCACTCTGGTTCCAATCTCGTTTCATGTGTAGGAACTCGTGTTTTGACCACGATCTAA
GTTGATCCATCGCCTTCTGACTCAACAACAACAGACCAGAAGCTTTGCACGCGATCTCACCACGCATCTGGCGGATTACCAGATTAGAGTCGCCGCAGAT
CACAATCCGCCCCCTGTCCATGGTGGACAGCAGATCGAAGCATAACAACAACCCGCGGTACTCAGCCTCGTTCACAGTCAGATCGGGCATATATTCTGAT
GCGGCGGTTACGATCGTCCACTCTGGCAACTTCCATATGATCGCACTGTAAGCTCCACCACTGCGTTTGACACGTGCCGATCCATCGAAACTTGCGATCA
ACAAAGTTTCGTCCGCTTCGAACGTAGTTGGTGGCATGGTAATCGTCTGTCGGGGCTGCTTCACGGGTGCAATCGCGATCAACGCCTCGTCTACTTCCGC
TTGAGGTGTGATGCTTGCTGCCATCGTGCCTAAGATTTCGTCTTCCCCTTTCGTGCACTTCCTGATCTCCAGTGTCCACTCTGATAGCAAGGCTGCCCAA
TTGCCAAGTCTCCCCTGGAGACTGGCTGAATTGACTAACCAAGCCAGCGTCGAATGCCTGGACAGCACCAAGATCGATCCCGTCGTCAGCAAGGTGTAAT
TCACGTCCAGCATCCGCAAGAGTGCCAAGACTTCTTTGTCGACAATCCCGTAGTTGATCTCGTTAGGTTTCAGAGTACGACTGGTGAAGGTTACGGCCAG
TACACGCCATCATGTTCATGCACAAGAGCTGCGGAGATCGCCCACTGACTCGCGTAAACTACGATCACCGGAGTGCGATCTGCGTCGAAATGCTTCAGGA
TCGGGGTGGACACGATCTTGGCTTTCAGCATCGTGAACGCGATCTTCCCTCGGGCCCAGCGGTCAGCGTCTTCCGCTCGCGGGACAGCGCCCCCAGCTAC
TTGTTCGCTAAGGATGGGTTTGTCCTGTTGAGCAATCTCGTGGAAGTCCGCTTCGCGCAGCTCGTATAATACAGCGGCATAGATCGCGAAGTCTTCGATG
AAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGGGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGGTTTTTCGGATGGG
CTTCCAAACCGTCGGCGGATACCTGATGTCCCAGGTAGTATACCTTTCGTCGGCCCCAGAAACTCTTGACCACGCTGATAGACAAATTCCATCGCTCGCA
TGCGTCGAGCAGCGCCTCTACCTTTTCGCACAGCAAGTCCCAAGTGATCGCGGTCACCAGAATATCATCGATGTACGATCGCCTTCTCAACACTGACGGT
TTCGGCTCTAGTTCCGGCTCGCCTGACTCGAACACGTCGATCGGTTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTATCGA
TCAACCACTGGTAGATCTGTGGCGCATTCTTCAGCCCGAAAGGCATACGCGTCCACTCGAACAATCCGAGTGGCGTGATAAAAGCGGAGATCTTCCGTGC
GCGCTCCGTCATGGAGACTACCCAGAAGCCACTCGTCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAATTCTTCCAAGAGATCGCTAATCAGCGGC
ATGGGATACACCATCAGTCTCGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAG
AGGCCCACGGTGAAGTTGACGGCGTGATCGTCTTTGCCGATAACAGACTCTTGATCAGATCTGACAACTTCTCGCGGAACTGTGGAGCGACTTTTCGGAC
GCGTTGTGGAACGGGCCCTCTCCCACATCGATGTCGCAGACTGCGCCGACGACTGCCGGTGGTAGCGTGTTCCCTTTCCCGATCAGGAGATGTTTCCGTC
TCCAAATTATCTGTCGCAGCTGATCGATTTCTTCCGGAGTGTTCGACTCTGGATCGCCCACCTGGATATCCTGGATCGTGACCTCATCGGTGGCGGTCAC
TACCTCTGGCAGAATTGCCATCTGTCGTTCTACATCTTCGGCGAAGAGATCGCCACCTTCGTGGTAACATACTTCCTCGTCGTCGGGTAGTCGCGTTTCG
GTCCTGGGCGAAGGCTCCTCCTGATCTCTCGGGGATCTTTCGGTTTCTGGTCTCATCTTAGCGGGTTGGGGCGCGGCTAGTTGTGCGACGATCAACTTCG
GGGCTCTACGATCGCGACGCAAGACTTCTGTCGGTGTGTCGTACCGGGGCCGATCTACCATGGGTCCGATAGGAGCGATCTTAGGTTCCTCCGCACCCAC
ACGGTCTGTGGTGGACTGGAACGCCAAATTCTGCCACTCGGCATACCGACGCGATCCAACTAATATGAACCCAGGGATGCGAGGTACGCATCCTCCTTCA
AGCCACATGCCGATGTGGGTATCA