Description :
From Genome Similarity Track
Location :
Scaffold_3001:1196- 2683
Sequence
1487 bases(100 bases per row)
CGTTCACATAGAACGAAGTGTAGCCTGTCGAGGCGTGCACTGCATTACTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTC
AGCGCATACGCTTCGGAGGGTATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTTCGCTGTGGACATGTCCAAACGAGTG
CCGAGCACTCTGAAGAGGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCGG
TCTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTATACCCG
TGTTTCCCGCCTAATCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAGCATCCCTTGGGGACAGGCAAACTCGCCAATGGCTCTGCCGT
GCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACATCTTGGGTCACTAGTACATCGAGCTCACCGAG
CCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCGTAAAGGATTCGATACTTTAGATCCTCATCATGAAAAAAGACTACAC
GAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGA
GTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCCCCGCGTATCAAGTCAGGCACTGACGACGTCACT
GTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGG
CAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAACGCTTAGA
GCCTAGCAGGTGTACCCTGAAATTGACTAGAGCATACTTCATTGCAAGTAGCTCTCTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGA
GACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGAC
TATCCGGGTCCGGTAGCGCAAGGATTGGAGCCTGGAGGAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCAACGTTCCAGCACCATGGTGCGTC
GATCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTCGCGCTGTACTGTGTGCAAGTAATTGGCTAAGCCTAGCCACT