Description :
From Genome Similarity Track
Location :
Scaffold_2450:1196- 2581
Transcript NameFunction/comments
Phypl_g15095hypothetical protein

Sequence
1385 bases(100 bases per row)
NACCTTCAACAGTAAGAGAAGAGCTagcacctcctcctcggtcaGATGGTAATTCATCTCAGCATCCTTCAATACGCGGCCACAGAACCGGACTGGATGC
AATCGCCCGTCGTGCTCTTACATCAACGTGGAACCCAGAACCCACTCATTCGCAAATAGCATGACATGCACGGCCTTGTCTCGGTCGAAATGCCGCAGTA
TTGGTGCGGTCACAACCCTCTGTTGCAGCGCCGTAAAACTCCGCTTGGCTACCGTGACGTCACCCCCGGGTAGGAAATCTTCGTCTTTCAGCTGGCACAG
AGCAGCTCCATACACAGCAAAGTCCTGGATGAACCGGCTGTAATAGTTGAGTGCCCCAAGGAACGACTGCATTCCCTTCTTCGACGTCGGGAACGGCAGC
TCGGACACGGCTTTTACCTTCTTGGAATCGGCTCGTATACCCTCAGACGACACCTCGTGCGACAGGAAGTCCACCCCTGACTGGACGAAGATGCCTTTCG
TGAAGCTAACACTGATCCGACACTCTGTAAAGCGCTGAAGCAGCCGGTCGAGAGTCGTTAAACACGCATCAAACGTCTCTGAGCCAAAGCAAATATCATC
CACAAACGATCGTTGATCGAACACAGGCACCAACGAGGATTCGTCGGGCTCGCCATTAGCGAACATGTCCACAATCGGACTGTTCACCAGCAAGGCGACG
GCATCCATGTTGGTCGAGGACGCTCGGTCGGCCTCAAACTTGGTCGGACAGGCTGTCATATCGTCCCTGAGCAGCGGAGAGTCCTCGGTCACCCCTGTCC
GAGCAGCATTGGCTTCCTCCTCAGCGGCCCGCATGAGCTCCGAgaagtgtagccatccgCCTTTCGGTTGGACAAAACCCCATAGAGTGTTGTCGATCAT
CCGCTGATAAATCATCGGCGCATCCTTGAGCCCGAATGGCATTCGTAGCCACTCGAAGTGCCCCAGTGCGCTCACGNGTGCGCTCACGAAGGAGTAGGCC
TTCCGAGCTCTCATGGTCATCAGGATGGCCCAGAATCCGCTGGCTGCATCCAAGGAGCAGAACCATAGGTAGGCCTCCATATCTGTCAACAAATCATCCA
CAAGCGGCATAGCGTATTCCATGATCGCGGTCACCGCGTTCAGCATCTTGTAGTCGATGCATAGACGGATATCAACGCCGTTTTTCTTGAGGACAATCAC
AATCGGCGACGCCCATGGGCTGTCCGAGAACGCGATCAGGCCAGCCTTCAGCAACCTCTTCAGAAGCTCATACAGCTTCCGAAGATGGCGGAGCGGTGTC
CTCCGAGCCCTCTGTTTGATCGATGGGTTTCGCTGTACGTCGATATCGCATACCACGCCGTACACAGGCGGCGGAAGAGCATTCC