Description :
From Genome Similarity Track
Location :
Scaffold_15:119599- 121040
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_22158Hypothetical protein

Sequence
1441 bases(100 bases per row)
TCACCCTTCTTGGGGCAATTGCTACCATTGCCGCCGCAGATGGGCCCCGGCACGCAGTACGTGGCGTCACCTGCGACGCTCACCGGAATGCACGCCGCAT
TCGCGTTCGCTTCAGCCGCCGCCTTCTTCTTGTCAAAGACGCAGCCGCGGACATGGGGCGCGATCGTCTCGCAGGTCGCATCCATTGGCGCGACGCACTT
GTCGGCGCTAACGTAGCTGTCGAGGCCCTTGAGGCAGTGGGCAGTGGCCACATCGCCCTTCTTCGGGCACCCACCATGCTCGCCACCGCACACTGGGCCC
TCGATGCAATATGTGGCATCGGCAACAATACTGATCATGGAGCACTTGCTCGACGGCGCACTCGGGGTCGACGTCTTGGCGGCTGCCGTCGTCGAAGGCA
GCACGGTGCCATTGTTGTGGACCGGTGCCGTCGTCGCCGGCGTCGAAGCGTTCGTCGGCGTCACGGACGGTGTGGTGGGTGTAGAGGTTCGGACGGGAAC
AGCCGTTCCGTTCGAAGACGGGGCCGGGGTCGGCGACGCCGAATCCTTCGTCGTCGGCGCCGGCGTCGAGGCGGTCGGCGTCGGGGTCGACGAGCTACCT
GTGGTGGGCGCCGGTGCCGTGGTGCTACTTTGCGTCGATGTAGGGGCGTTCGTCGTCGGAGCATTCGTGGGCGCCGTCGTCGGAGCCGCTGTGCTCGGCG
ATGGGGACGGAGAGGGCCCTGCAGTCGAAGGGCTCGGAGTCGCCGGCGCGGTCGTAGGCGCGGTCGTCGGCGCAGTCGTAGGCGCGGTCGTCGGCGCGGT
CGTGGGGGCCGACGTAGGAGCCGGCGTCGAGGCGGCAGCAGTCGTTGGCGCCGGCGTTGTTGCTGGCGACCGGTCGCACACCAACGCATCGGCCTGGCAC
TTTTGGAACACGGGCGTGCCGCATTCGTCCGAGGTCTTGGCCTTGCGGCAGACGTTGGCGCACATGTAGCCCGGCGACGTGCTGCCGCAAGTGCAGAACA
TGCTGCAGTCGTTCGCGGCGTCTTCCGTGTTGCACGCTTTGAGGCAAAAGTCGTTCGTGCGGGCGTCGCTGTTGGCGACACACACCTTGGCCGTGCACGT
CACGAGCTGGCCGGACGAGGACGCGGCGAGAAGCGCCAGGATGGCGAGGACGTGAGGTACTGCGCGCATGAGGCACGAGCAGTCGAATTGGAGAAATGGG
CTGCGCGCGACGATCCCGCCCACGTTACATGCCTCCTGTCTGGCTATCCACGGTGTGACACGCTCCGCATGTCCTTGAGGTTAGAAAAAGCCTCGGTCGC
CTCTACCACTCCTCCCGCGCTGTGGAACCCGCCACCCGGCCGCTGGTTGCACTCACACGCCACTTTCACAAGCACGCGCGATTGCTCACAGGCAACGCCA
AGTGGCCGCGCGGAACGCTACACTATTACACGGGCGCCCAC