Description :
From Genome Similarity Track
Location :
Scaffold_21:11955- 31242
Transcript NameFunction/comments
Phyke_g1347putative glycosyl transferase family 48 protein
Phyke_g1348hypothetical protein
Phyke_g1349conserved hypothetical protein
Phyke_g1350hypothetical protein PHYSODRAFT_536864
Phyke_g1351hypothetical protein
Phyke_g1352hypothetical protein PHYSODRAFT_466952
Phyke_g1353hypothetical protein PHYSODRAFT_554422

Sequence
19287 bases(100 bases per row)
AGTTTTGTTACACCGGTGGCTTTGTGGAAGTGCGAGCAATGCTGCCTGGCAAGTGGGGCGTCCCTGGTACGTGGCCAGCTATCTGGATCATGGGAAACCT
TGGTCGTGCCGCGTTCTTAGGCTCTCAGGACGGTACTTGGCCATGGAGTTTTGACGTATGTGCTCCCTTTGTGGAGAAGGTCGAGAAGGTCAAGCAAAAA
ATCAATGCCTGTGGCAACTTGACCAACAAACATGACAAGGAATCGTACCCGGAGATGTACGGATTGAACCCGTTCCAAGGCCGTGGTGCGACCGAGATTG
ATGTCATTGAAGCGCAGATTCGAGCACGCGATGAACCGGCGTACGTCTCGACGTCGTTGCAGATCCGTCCTAGTTTATCTGATGACATGCGTCCGCCTTC
GGAGAGGCTGCCCAGCCCTGAACAATGGTACCAAGGTCTTAAGTTCGGCAACTTCACTCGAATTAATAGTGACTACTACGGTGAATTGGGTCTTGACTCC
ATTTCAGCGCTGACGCAGCTTCAACCTGATGCGTTTAGAGCATACCACTTGTACCGGTTGGATTGGTCGCCAGGTCCGGAAGGATACATCCGTTGGTGGA
TGGATGGAAACTTTATGTTTGAAATCCCTGGATCAGCCTTGAACAAGTGGGTGGGAGATGTGCCTCCTCGCCAGATTCCTGTGGAACCCAGCTACCTCAT
TCTGAGTACTGCTGTTTCAGAGAAGTTCTCTCCACCTTGCCAAGGTCAAATTTGTGATTCACTGTGGCCCTCGAACTTCACGATTGACTACGTGCGTGTG
TACCAGGGTAACCCGAACCGGTACACATCTCTGGGTTGCAACCCCGCGGCATACCCAACGACGGATTGGATCTACGCACACCCGGTGGACTTTGGTCTTC
CGTGGTATGTCTCACTTCGCGTTGACATCGGTCTCGTGCAGATCTTCGCAATAGCCAATGCATTGGTGGGACTCTTCATTGCGTTCCGTGGCACGACGCA
TCCTAAGTTGGCGTCGGCTTATATCAGCACATTGTGGCTCACTGCGTCATTTTATGGAGCTTTGAGTTCGAGCGCCCCAGAAGATCTAGCTTGGATCCAG
GCTGCGATTGCGTGCCTGTGCGGTGTAGTGCTCGGCGGCGTTTGCAGCTTGATGTATCCCATTTCGCTTGGTGCGATGCTCGGCTTGTACGGTGGCATCA
TGATTAGCCAGTTTGTGCCAATATTGTCTTCACGTGTGGTTACTGCTATGCTTGTGGGCGTTGGTATTGCCTTAGGGTGTGTGCCACGGGTGGACAACAA
ACACGTTGTTATTCTGTCTACATCGTGGATTGGTAGCCTGGCGTTCTTGCTGTCGATGTCACTGTGGGTGAGCGAAGGTGACATTGTGGAAAACGTGTGG
AGTCTCGCTGGATTTGTCTTCAGCGGGAACGATAACGACCATTTAAGTTTCTGTTCGGAACACTGCTGGGCGATGTATGGACTGCTTGTTGCGCTTACAT
CGGTAAGCACCGGTTACGCGTATTATCGTATGCGTGGCGTATCGATGCGTATTGCAGTGCGAAAGACTAAATTTCCGACTGTGTCCGCTAGCTCAGACGC
TCGATCGTGGAGGCCAGAAAATGATGGGGCCTCGGCAACGGGTAAGAGCGATGTGAACTTCTTCTCACCAGCCAAGCTGCCGCACAACATGCAGCAGTTC
AGCACTATTTTCCGTATTGCTGTGAACGTGCAGCGCTCGTTTGGCTTCCAGCTTGACAATTTCCGCAACCAGACAGAGCACATCGTGATCCTACTCACGA
ATAACACACGTAGAGGAGGAAATCCGTACAGAAAGCTGCACAATTTGGTGTTCTCGAACTACAGTAACTGGTGCCTAAAGCTGCACATCCAACCATTGCA
GTGGAGTGAGCAGCGGGCTCCTCAGGGCGGGCTAACCAGTGTCGACGAGATATCCGTGGATTTGTGTCTTTTCTTCTTTATCTGGGGCGAGTCCGCCAAT
CTGCGGCACTCACCGGAGTTTTTGTGTTTCCTCTTccacaagatgaaggaggagttCCCGTCGGTTCGTCACACTGAACGCGAGGCTGGGCACTTTCTGG
ACACGGTGGTGACACCTGTGTATGGTTTGCTGAGGTCTGAAATGACGTCCAAGTATGATCACGAAGACCGCCACAACTATGACGACTTCAATGAGTTCTT
CTGGACAAAGGCGTGTTTGAAGTTCGACTACAAGCACGAAGAAGTTATTGATCTCACTTCGCCCAACCCAGCCATGATTTATAAACAGAAGAAGGCTCAG
CGTGAGGGCTTGGGAGGCGGGTGTAGTAGTCGAAGTGGCCTCAATGGTGGTGCCAACAGTAACTTCATCCACAAGCGCAAAAGCATTGCTGAGGGCTTCA
CAGAGTCGGCGAAGTCGTTCATGGAGAAGCGTACATGGCTAATGCCACTGCGCGCGTTCTATCgcatcttcaacttccatGTTATCTCATTTCACTTCTT
GGTTGTGCTCGCGTTCGCTAGCGAACAGGAGATGAATCTCGAAGATTCATTAAAGATTGTGGCGAGCGCTTTGATCACGCCGTTTTTGCTGGACATCCTG
CGCGACGGGCTTGATTTATTTGCTGTGTTCGACGAGCACCAGCCAGCGTTCTCGACGACGCGTAATGTTGTGCGTGTGGTTTTCCACCTGTTGTTGGCAG
TGGTTTCTTCAATGTTGTACTGGTATGCATGGACGTATGGTGGCGTGTGGTGGAGTTGGTACTACTCAGTCGTGCTGATTTTCCATGTGCCGGGTCTGAT
CAACTGTGCCATGCAAATGATGCCTGGGCTTACAAACTGGACGCGTCGCACTCAATTCACCCCTGTCGCTTTTGTTCGCAATATCATTAGCCCGATGAAC
CGATTGTACGTAGGCGATAACGTGTTGGACCCAGAGTCGATGAGTGTGGGGTACCAATTCTTCTGGGTTACGATGCTGTCTTGGAAGCTGTTCTTTAGCT
ACAAATTCGAAATCTACCCGCTCGTGATACCGAGTTTATTGCTGTACGCAGATCACGTGGAGAACAAGGTCAGCATAATCACGACTGTGATTCTCATCTT
TATCAACTGGCTGCCGTTCTTCCTGATTTTCTGTGTAGATATCACCATTTGGAACTCCATCTGGATGGCTTTTACGGGCACTTTTGTCGGCTTCTCGTCT
CGCATTGGTGAGATCCGCAATTTCAGCCGTGTTCGCTCAGCATTCAGTCGCTCTGTGGATGCGTTTAATGCAAAGGTGATCTCAGCGAACTCGAAGACTG
GACTCCAACTTGCGGAAAGTGCGGGGTTGTCATATGGAACAACCTCTGTAGGTCACGAAGTGTTGGATCGCATTGCGGGTGGTGCAGATCCGACATCCCG
AATCTTGTCTCAACGACGCACTTCTTCGCATGACGATGAGACTCCTCTTTTATCTTTCTCACGCCGTAAGCAGACCCCCCTGGAACGCCAGGCAGCGCGG
CGACGCAAATGGTACTCGTTCTCGGTGGCTTGGAATACTATTATCGATAGTATGCGTGCGGACGACTTGATCTCGAACAAGGAAAAGTCTCTGCTTCACT
TTCATCGTCTGGACGGATATCAACGCGAAATCTATCTGCCGCAGTTTCAGTTGGCTGGCTGTTTCGAAAATTTTACGTCGGACATTCTGGATATCTACTC
GTCGAATGACGGCAATGTGACTGAGCGTGTGCTGCAagacaagctgctggaaatcCTAAGTGAGAGCCCTATGGTGGAAGAATCTCTAGAAGAAATCTGG
GAGCTCGCGAACTGGGTACTCATCAACGTTCTTGGACCGTGTCACTCGAATGACGTGAAATACATTACCAGCGTACTCAGCTCGTGGGCGTCGCGCGGCG
TATTCCGTGCCCTAAATCTGCAGAAGGTGGATTCCTGTGGTCGCGCTTTGGCGGGCTTAgtgtcgctgctgaaaaCAAATGCTCGCACCTGGAAGAACGG
TGCTAAAGTGATCCCTGTTCGCAAAGATCCGTCTGAGTACGCCTCTTATGAGTTCCCACAGCAGTCAAGCTCATACCgttctgcgtcttctggtcTTACC
AAGTCCGCAAGTACGACGGGTTTGTCTTCTTTGGGTCTTGAACCTCCTCGTCGCAGCCGAGGTTCTGGTGTCGCGCGTATTGCACGTAtgcaacaacaga
cacatAAGCCTGCGATTAACAATGGCAAGGCTGCTCACTCTATCCCGAGCTCTCACATTATGCAAATTCGTGAACGCGTCCGAacgttcttgaacttggg
cAAGGAGATGTTGGCCCATGTCCATGAGCAAGACCCGGTCTACGCTGAAAGCAAGGGTATTTCTGACAGACTCACATGGATTCTTACACAAGAGCGTGGT
TTCATGTGGGACGACAGCTACACGGGTGAGCAAATTACGCTAACGGCATTTGAAAGCCACACAGAAGTGGTTCTGTCGCACCTGTACGGGTTGCTCACAT
TACAGAAGATCGATGCTGAACCACAGTCATTTGACGCGCGCCGCCggctgctgttcttcgtgAACTCGCTGTTTATGGACATGCCTTTGGCCCCGTTGCT
CGAGGAGATGAAGTCATGGAGTGTGATAACGCCATTCTACGCTGAGGATGTCTTGTATTCCAGAAAAGACCTGGAAAGTAAGCAGGATGGCCTGGATGTA
CACACGCTACTATTCCTGCAGACATTGTACAAGAAGGATTGGGAAAATTTCCTGGAGCGAGTgaaacccaagaagaacaTTTGGAAGGACCCAGATACAG
CCATTGAGTTGCGCATGTGGGCTTCACTGCGCGGTCAGACGCTTACACGCACGGTACAGGGTATGATGTACGGTGAGGCGGCTATTCGCCTGCTTGCCGA
TATTGAACAAGTTCCACAACAGAAacttgaagagctgattAACACCAAGTTCACGTACGTCGTGGCGTGCCAGATTTACGGCCGTCAGAAAAAGAACAAC
GACCCCAAGGCCAGCGATATCGAATTTTTACTGCACCGGTTCCCGAACCTCCGTGTGGCTTACATCGATGAAGTGCGTGTGAACTACCAGAAGGAGCAAT
CGTACTTTTCAGTGCTCATTAaaggaggtgaagaactTGGCTCGGTGCATGAAATCTACCGCGTGCGGCTGCCAGGTAACCCCATCCTGGGCGAGGGCAA
GCCGGAGAACCAGAACTCAGCCATCGTCTTTACTCGTGGTGAGAACCTGCAGACAATCGATATGAACCAGGATGGATATCTTGAGGAAGGGCTTAAAATG
CGCAATTTGTTGGAAGAATTTGACAAGGGTACGGCTGAGCGACCGAATACGATTGTTGGCATCCCGGAGCACATTTTCACGGGCAGCGTAAGTTCTCTGG
CTAACTACATGGCCCTCCAAGAGACATCGTTCGTGACGCTAAGCCAGCGGACGTTGGCACGGCCTTTGCGTATGCGTCTGCACTATGGCCACCCAGACGT
GTTCAATAAgctgttcttcatcacgcGTGGTGGTATTAGCAAAGCCAGCAAAGGTATCAACCTCAGTGAAGATATTTTCGCTGGCTACAACAATTGCATG
CGAGGTGGTTCTGTGACCTTCCCGGAGTACACGAAGTGTGGTAAGGGGCGTGATGTCGGTATGCAGCAGATTTACAAGTTCGAGGCAAAGCTAGCGCAAG
GTGCTGCCGAGCAATCGCTTTCCCGCGACGTGTATCGAATTAGCCAGCGGTTGGACttcttcaagttgctgtcgtttTACTACAATCACGTGGGTTTTTA
CCTGTCGATGTCCGTCATTATTTGGACGGTGTACATCCTGTTGTATTGCAACCTGCTGCGtgcgctgctctcgttgGAGGGTGTCGGAGGCCGTGAGCCG
GTGTTGCTGAGCCAGTTGCAATTGATGCTGGGATCTGTTGCTTTCCTCACGACGGCACCGCTGTTGGCGACGATCTCGGTCGAGCGTGGCTTCAAGGCCG
CCCTGAACGAAATTGTGGTCCTTTTCGTAACTGGTGGTCCTCTGTACTTCCTGTTCCACATCGGCACGAAGTGGTTCTACTTTGGACAGACAATTCTTGC
GGGTGGTGCCAAGTACCGTGCTACCGGTCGTGGTTTCGTGACGAAGCATTCGTCTTTCGATGAACTCTATCGCTTCTATGCAAGCAGCCACCTGTATGCT
GCTCTGGAGATCGCCATCGGACTTGTCATCTACTATACGTTTACTGTTGGATTTCAGTACTTCGCGATGACCTGGTCGCTGTGGCTTGTCTTCGTGTCGT
GGTACTGGTCTCCATTCTGGTTCAATCCTCTGGCGTTCGAATGGTCTGACGTGATGGAGGACTTCCGGTTGTGGTTCAAGTGGATGCGGGGTGACGGTGG
TAATCCAAATCAATCATGGGAGGCGTGGTTTAAGGAAGAGAACGCGTACTTCTCGACGCTACGTCCTTGGTCCAAGGCGTGTGTCACTATTAAGGGTGCG
CTGTTCGCGTTTATCGCACTGTCCATCTCGTCCACTGGCGATAAATATCACTCGCTCCTGACGAAATATACGTGGATCCCATTCGCtatctgctgctcca
tggCTGCGGTGTATCTGAGTGCTGAGTCGGCAATCTTCTCTTCATCACGCTCCCACGGCGAGAACGGACTTGTTCGATTTTTGAAGCTTGttttggtgtt
ggtgctgggctCTGGCCTTGTTGTCGCTTTGGTATATGTGGACGGCATGTGGCAGTGCTTGCTGGGTATGGGATAccttgctgcagctgtgggcTGTTGG
GCACTAGTGCTCTTGGGAAGCAACTCGCGTTTCGTTGGAACCCTTTACTTTGTGCATGATGCGGTGTTGGGATTGGTGTCTCTCAGCATCATCACGTTTC
TGTCGGCACTCTATGTTCCCGGGAAGATTCAGACGTGGTTGCTTTACAACAATGCGTTGAGCCGAGGAGTAGTGATTGAGGATATTCTGAGGGCCAACTC
GAGCAACGAAGACCGCGACGACGATCTGTCAGTGCAGCAAATGCGCTCCATTAtcatcgagcagcagcgctttCTCAATGTGCTGACTGCCAGCGGTAGT
GAGACGGACATGCGCGCCGTCGGCCCCGGAAAAATGAAAGAGGACCTGATGCACGCGATGAGCGACAACACCCTCAATGCTGTGCTACGCAACATGTCCG
AGACAGAGCTAAGTGCGTTGCAGAATTCATCCAGTCGCCTGCAGGCTATCATGTCAGAGGAGGAACGCAAGGTCCAGCAacgcaagcagcagcaagatga
agctggcTCCAATCCCTCGCTGTCTCGCACTCGCCGTGCTTTCTCGACGAGCGATTTCGGAAGCCTCACAGCGAACGCGAGCCCTTACAACCTCCcgaac
gctgcagcagcacccaaTGGCGCCTCGAACGGTAACGGTGCGCACACTGGTATGTAAATGTCTAGACTTAGATAAACATTTTGGATAAAAGCTTCTCTTT
GTTCATATGCTTGACTAGCATGCTCGAGTCTCTTATGATTGGCTTTCCACAGCATCTACCAATGCACAGCGGTTGTTACACTACGGGGACCAACAGATAA
TATACACACGGACGCTGCTTCGCGACGTAATCGAATCTATGAGTACCGGAAACAGCAGTTGACGGACAGCATCAACGTGCACCGGTGGTGGCCGCTGGTA
CGGACATTGTGATGGCGGCGTCGGGTTCATTGACGTGACAAATCGACTTTCGGCTCCTCAAGCGTCCGACTGCTTTCTGGGCTTCTTGCCGAAGCCACTC
AAGAATTTCATATTCGCGCTAAACTTTTTGGTGAGCGAGCTTTTCTGCAGCGAATCAGCGCCATTCAGTACGGCCGCCTTGAAGCTCTCGGTAACGTCGG
GcgcacagctgcaggactCTAACTTTttctcaatctccaccaAGTTTTTCTCCGAAATAGACCGGATGACCACCAAATCCTCAATCAACTTTGACGAAGG
CACGTGCGAGTAGATCTTACGACTGTCCGACGAAAAGCACTCGTCAATGTCTTGGCTGGGCGACATGGCCAAGTTGGCGAAGAGCTGTTGGATTGCCGGG
GAGTTTTTTTCAATGAATGGGTTGAGCACtctgcaagagcaagaaattgATGGTGAGTATAACTGAACAGCGACGCGTATTCTCAATTCGCCACACGTAC
TTAAATTGAGGCTCTCGGTCACCAAATTTCACACCCGTCGCCGTTTTGAACAACAGCTTTGTGACGAGCACAAGCACTCGTCGAGTCTCAGGTGGAGGAA
GCTGCTTTGTAAGGCCGTACAAGTGTGGAGTGGTGATGGCCGGACACACAAAgcggaggaagaggaagccgCCGATCACCGACTAGTTGCAAGTGTAAAC
AAGTACCACCGAGTCAGTCcccaagaaaaacaacaCGTGAACACGAGCGACGTACCCGAGTGAGCGTGGATGCGTCCTCTGCTTCAACACCTTCCTTTGA
TCCGTCAAAGCGACTGATAACCTTAGAATTCAGGTGAGAGCATATGTGGAAATAGGATGACGGAATCTGTAGTGAAGGTAATACAAGATTAGTCCCCAGA
TAgcagaaaaagaaaagcaTCACAGCACGTACGTAGTTGGTGTTCTTCATGATCGAGTCAATAATGTTCTGGCATGTCCGCATCAGGTTTTCGGCATTGG
CATTAGCTTGAGCCTCATCCTGCAGTGACTCCTCCTTATGCGGGTTCAGCTCCATATCAGCAATTTTCAGCTTAAATATCTGGTGAATAGGGTCCGAGAG
AGCCACTCGAATAAACTTGGAGCCGATAGCCTTGCTGTATGTGGACACTAATCTGCTGGCATAGTCGTCCGAACGGAAGAGTGTAGCCACATTGATGACA
GACGCGACTTCAATCTCAATTGCCCAACGGATGAGATGGCTCAGGCGGTTACGACTTCCGAAAACTCGAAGGAATGGAcctagcagcagcatcttaTCGT
CTCGTCCAGCACTCTGAAGGATTGATGCCACTACTGACATTGTGTCTTCAACTACCAGGGACGGAAGATCCCTAGGTGCTGCCGGTGGGGGCACTCGAAC
TGACACCTCGAAATCGCCATTGAGAAAATCGCGCGCAGATCTTGCGTGAGAGAATAGAGTGCGTATCCTAGGGCTTGGGCCGTTAGCAGAGCCTGTTGCA
GGTGACCCTGATCGTAGAGCACGCTGCCGATGAGCCTCGTCGAGGTCATCAATTTCTTTTGGCGATTTGGAGCCAATTCCTTGTTGAATCTCGGCAATGA
TTTCATCACTGATAATCAGCCGGTCTGGCTGACTCGGTTGTTCGGGCTGTGCGGATACGATAAAATCTTTCATGACCTGATGTATCGAATCCAAGAAGCC
ACTTGCCTCCAAAAACTGACTGTCCGACTGCAGTACGAGAACACACAAGAGCAAATGTCAGCAACGTTTGAAAATAATtttaaaaaaacacacaaGTAAA
CCAACTTACAGCATCAAACTCCGACAAACGCTCGATGTCGccgtcctcatcttcatcgaaGTAAAGGTCGTCTTGAGTAATAGAGAAAATGCTATCATTG
CTGTCGTTAGAGTTGATTTGATGGAGACCAAAATCTGTTACATCTGTCAAGAAGACGAACACATATTAGGATGTCAGCACaacccaagcagctcgagcac
CTGGAGCAAAAGCATACCTGAAAACGATGACTGAGATTCATTGAggagtgatgacgacgaacttGACGCGCTTTTTAAAACCTTCTGACCCGACTAAACG
CATAGTCGAACACAGGTAATGTTAGTAAAAAAAACTCACTGAGTGCTGTATTGCTGGTGAATAGAGAGAAACGTACCTTTGGTGGCTTCGGATCTACTCG
GAACGAAGATTGCAGGTTGCGCGCTATCTCCGCAAGCTCCATTGCCTGCTGTTGCAGGAAGTCACTACCGGCGCTGCCACTCCCATCGAAAATTCCCAGT
CCACTTTGTGTTCCCTTGAAGCTGGATGTAAGTGAACCATCGTCACTGCTTTCTCGTGTAGAAGATGAGTCTGTAAGGTCTTCTTTGTTCAAATTGCGCG
CCATCTCTGCcagttctgctgcttgttgctggattGAATCGTTCTCCGCAGCGTCATTCAAGTTCACAGACTTCGAGCTCAATTGTGAGGATGGCGATGC
CACGGGTGCCACGTATTTCTCGGACGATAATGGTGCGGATTCTTGCTTAGGTGACTTTGGCGTAGGCTCATGGTTGGGCGTTACGGACACTACCACAGAC
TCTTTCTTCGCTAATACTGGCACGACCACGTATTCTTGCGTTGACGAGTCTGGCACTGACACAGAGTCCTGCTTCAGCGATTCTGCTATTGACCCGTTCC
TTTGCATTGGTAATGCAATTATAGGTATCTCATCAACAGCCGACATGGTGTTCACCTTCTCAACATCTGTTTCGAGTCCGTCAGATACGGTATTCCGTCT
TTCTTGGCTGTTATCCATCTGTGTCTCCTCATCCACTGGAGTCCCAACGCTAATCTCGTCGTCATTTTCTTTCTGAACctgttcgccttcttcttcatca
tcagtCTCCTGcgtgtcatcgtcctccGACAACGCTTCCGAAATGCCCGAGTCCCGAGATATCTTGTTCAGTACAATCAAAGGCTCATTGACCTCGACTT
CCTGTAGTCcctgtgcttcttgttctgcCTCTTGAATCTCATCTCGTTTCCTCTTTTCCACCATCTCCAAACGTTTCTTAAGATGTTCAATCTCCtcttt
ctgcttctccacaacCTGCAACGCATCCTTCAACATCTCCGACGTGTCGTTATTATCCTCCGTTGTGCATCTCCGTCTCGCATAATGACTACGTGGCGAC
GGTGCTTGGGAGTGGAAACTCACAGCCGACGTCGCAGAATTCACCGACGTCGAACTCGATGATCTCGACAATCTCCTGGCCAGTGCAAGAGCTGCCTTGC
CGTCAATACTCCCTCTTCTCAGTCCAAAAGTGTCCATCGCTTCCCCTGTGGCTTGACGCAGTGTTTCAATCCACTCCAATCGTGCCTCATGGGACGGAGA
GCGGAACAGCAAGACCCgcccgctgctgctcgtgacCTTCCAGCAAGGTCCACAGTCGTCGCCTGCGCTCGCGGCGTCTCCATGACGGAAGATGCGGTCC
ACAGACTTTACATCGGCGCCAGTGAGGGGCACGACGCCTCTGGGCCAGTCCCCTAGATTTGCGTAATAGAATAGTGTACGGGCGTAGATCCCCACAAAGA
ATGGTTCCCAGGGGGACTCAAAGCGTCTTCCTTTCTTGTGAAGAATGCGCAGTGTAGTGCGTCGTTCCAGCTCCACGCCTCGCAGTAGGAATTCGGGGCA
CTTGATGAGTTCTGGGTGTGCTTCCTGGTCCTCTGGTATCTGTACGGAAAGCCTCGATGCCCCTAGACTGGAGacgcgactgctgcttggatCGAATACA
GAAGCTCGTATTGACATGACCACCTACTACAGCCAAGGCTCTAATTGTGGAGTGATCGGGTCACAGTGCAGAGGGATGTTAGGAAAAGGCAAGTTGGGCG
CGGTGTTAGGGCAGCGAACCGGTGCGAGGCAAATGTATGAGTTTCAGTATGAACGATGGACGCCCGGTGCTGTTCACTTGAAACGTCGGTTTGTATCAGA
GACAGCAGACAGGCCACTGCGAGAGAGGACGACGGGGCGTCCGTCAGAATAcatagtgaaaccaagtgaatTTCTCTAATGCGGGATAGACACGCTAACA
TGAACATCGCCGATGAAAGACCGCCATGGCTAGGAGGCGAACACAAGGGTCGAAGCAGCGCTTGACAAGCACTCGACCATCAACGGCAACAAAAGTTAAA
TGTGTATAACGGCCTTCATGAACCATGCTTGCTAGCTATGCTTGTAGACTGTTCTTCAATCAGAGCGAAACCCTCGTTGTTGTGGACGCCGTAGGTACAA
CTACAATTTCTAGCACACTGGAACTCTGGCTTTTTTTACTTGAAGCCGCTCTCGGTGCGGTCGCCGGTCGGCGCGAAGGCGGAACGCGTGGCGGAGCGCG
TACTATAGCTGGTTTTTGGTCATCATGTCGCTGCCCTCACGTCTACCACCGTACACTTTAGACAAGTGCCGATGCTGTCCGCACAGTGTAAGGGCGGAAA
ATCGTGTTCAGCACAGTGCGCTCCTACCTTTCCACATCCCAAGCACTTGTGTCTTTCCAATTCCCGAAATCACAATATATGGGCAACGTTCGTTCACTTG
GCGCTTCTCGGAAAAAGTTCAGGGATGCAATGGAAGCCAGAGAACGGAGCTCCTCGCAGCGTCTCCTTCCAAAAAAAAAGCAAAGCTTTCGTGCAGTGTT
CGAAACTAAATTCACCAGTTTGCATCACGACATCGGCGCATATGCGTGAGGTGCCGACATGCATATTATGAGGTGTCGACATGCATACCAGGAATGTCAT
CTCTTTGGGGCCGTCCGCACACTTCACGAGGTAGCTTGCCTTTCGGTGGAGTCATCAACAAACTGTCTCCAAGCAAATCCGATTACCGTGACGTCCGACC
GACAGCAGTGTCGTCACGGTGACAGCGGGCGTCCAACGAAGTCTGTCGTGCTTGTGGGATCTCGTCGGTGGTCGTCGTGCACGCACGTTGATTTCCGCCC
CTTAAGTCAGCAAATTGGAAATGCGCTGAGCCGCAAACGTCGATCCCAGAAATGGCTGGATGACCGTAACAAACAACTCGGCTTGAAGACTGCAGCCTCT
TTCAGTTTGTGAGACCACAATCTGTGGCTGCAATACTTCTGACTTATCGCCATGGTTGTGGCCACAGGTCTGTGGAATAACGAACAGTAATTCATCTGGC
CTGATGGAGCGAACGGAGTCCACCCACGACTTGCTCTCCTATATGCACATTACGACAGAACGAACCattgttgttgaagtttcCTTTGACGTGGACCACA
CGTATGACCTTTACAACTGACTATGACATAGTGCAATTCAATTGCCCGAACCGTAACCGTGATTTAACCGTGTTTTAACCGCTCATGATCAGAGCCTGTG
GCCTCGAGTGGCGCGCTCTCGTCCATTCGGCCCTTTGATCAGCCCacaagcaaaagcagcatctTTCTCCCGTCTCGCTCGGTAGCCATGGTACGTTCTC
GATTGCTTGCTCTCGTTCTGCTCTCGGGAGATGGTTACAGCGGCCGGTAAAAGGAGAATGCAACGAGAAAGGGGGGAACACCCCCAGCTGTGACAAACGT
CCGTGTGATTGCCGCACGCGCGATCTTTGAGCGTTCAGTCCCGGGTCCGGTCTCCTTTCCCCCTTCAACCTCTAGACAGCTTCAATTCGCCCTTGTATCC
GTCTCCCTCCTTGATCTTTATAGGAACCATTTGTTTAACAGAACAGATTAACTGACTGGACGGTGGACTTACACAGGCAGCTAAGAACCAGAACATCTTC
GCCCTCCTCGACTCGGACGATGAGGACACGCCTCgtgtgaacaagaaggcgaCGCCCCCGCCGTCGGCCCCTGTGGCGCTGAACAAGCCCGCCGctggca
acaagaagaccaccaagaagccgGCCTctggcgacaagaaggagtCGCGTGGCCCGCGTGAAGGTGGCCGTGGCGAGAGCCGCCCGCGTGAGCGTGGCGA
CCGTGGCCGTGGCGACCGTGGCCGTGGACCTCGTCGTGAGTACGAGCGCCGCAGCGGCACGGGCCGTGGCAAGGAGACCAGCAAGCAGGGCGGTGGTGCC
CGCAACTGGGGAAACAAGGCTGACCCCAGCGAGCAGCTGGCTGAGGCTGCTGTCCAGGATGGCGCCAAGGTCTCGGACGAGGAGGCCGCTGTCGAGGAGC
CTGCcgtcgaggaggaggaacaggAGGTGCAGTACACGCTTGACGAGTAcctcgccaagaaggagtcGTCGCGCTCGGGCGAGATCTTTGCCAAGGTGGA
GGTCCGCCAGGTGGCCAACGAGTTCTCCAACGCGGTGCAAATCACCAAGGAGGGCAAGACCCCCGACTTCATGGACTCGCAGTACGAGAAGGTGTACAGC
AAGAAGACCTCGGGACGCAAGAAACAGGTTGTGGCTGACGTGGGTTTCCGCATGGAGAAGCCGGAGCGCAGCTTCCGTGATGACGCTCGTGGCGGACGTG
GCGGccgtggtggccgtggtgcTCGTGGCCAGGGCCGTACGGGTGGCCGTGGCGCTCGTGGTTCTTCTGCCCCGAACGTGACGGACATGAGCGCATTCCC
CAGCCTCGGCTAGAGGGATCGCGTAGCGACCAACCGACATCGCGCGCCGCAAGCGCCAGCGACATGATGAGTGAGATCTTCCACAAGAGGGCTTCTCGAG
GATTGGTTTGGCTATCtctttttctcctttttccCCCACACGAAAGATCCACACGATAGGGCTCTGCGCGGCTGGTGTCTGCCTGTGTGTCCATCTTGCA
GGTAGCCAGTCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGCGTGAACTCGGTCTTCTCTTTGGTATGTCTATTATTCAATGTAGCAGGCCGGGCTTT
ATGCGAACGAAGATACCTTTGTTGTCATGTGTGCGTTGCGTTCCTATTCATAtcttgttttttgttgttaTTTGATCGTACGACTTCGACTTGGCAAACT
TGTTGTTTATAATGCTCATTTAGACATTTGACAGTGGTGATTCTTTGCGCGCGGGGTCATTCTATCGAGTGCTACTACGTCTCGACGCGTACTATGATGG
TACGGCAAGCTGCTCGATAAAAAAATGCTTACCACCTGCTTTTAGTCTTCCACGCTTGAATACACCAACCTCGAACGGAGGTCTCGCTTCTGCGATGTAC
TCACTCTCACtttcatcgtcctcttcctcttcgtgcTCACGACAGAAGATCCCACGACCTGACGGAGAGCCATTAACCCACATACCAATAAATTTTCTTC
CATCGGGAGACGACCACGAACCATAACCTTGAATTACGCCCTTGACCCAGTCGCCATCATAAGTTTCCCCTGAGGCGAAGGTCAGTGTACCAACGCCACT
TCTTTCACTAGCTTTGAATCCACCAATGTAGGTGCTCCCACATCGAAAGTAGTGCACACCCTGGCCGTTGAGTTCGCCGTTTACCCAAGTTCCGTGAAGT
GAGCCCTCCATCGAAACGTAAACACCCTTACCGTGCATCATACCTTGGTGCCATGTGCCCTCATGGGTGTCCCCCCCTACCCACTCATACTTGCCAAAGC
CTTCACGCTCCCCCTTGCCAAAATAGCCTTCATACCTATCTCCCGAGCTAAAGGTTTTGATACCCCACCCGCTAACCAGGTTGTGCCTCCATGCACCATC
GATCGTTTCTCCAGAAGAGAAAATCTTCTTGCCTTTACCGTGCATCACTCCTCTCTTCCACTCGCCTAGACGAGATAGAACAACGTCAACTTTTATACTC
GAACAATCTAAGTGCCACCCTTGAGGCTCACCATCATAACTGTCGCCAttcttccagaagaaggTGCCATTCCCATGCATCTGCAATGAGATAGAATCCC
AACCGGCACACCACCACGCAACAGTCCACGGTCAGCCCCAATAGATGCTACCGTCGTTTGTGTAGCTCAATTCCCACCTTCCCAACACGCCAATTGCCGA
CGTATTTGTCACCATTAGCCCACAGATACGTTCCCACTCCATGCCGGTGATTCTTGTGGTACATGCCTTCGTGGCAATCACCTGTCCCCGCAAAGGTCTG
CGAGCCGAATCTATCGCATAGCCTAGTGAGTCTTCAATCAACTTATCACAGTCTTCCAACATTATGACGCACCCTTCAAACACTCCATGCACCCATGTAC
CCTTAAATACGTGGCCCACACATACAATGTACACACCAGAACCATGACGCcgctcgtcctcgtccacgtCGCCTTCGTAGCGACCGCCGTCTACATATTG
GATCACGACGGTTCCTTGAGGCTTCTTCCAGCGGATCGACAGAATCTCTGACTGCGTTCTACAGCGACCATACGGGGCTGACGTGTCTTCCGGCTGAGTC
TGCAcctgctgtttcttcacaCGGTCTGCAGCGATCGGGTTCTCTCTGTACGCTACAGTGCGAGATGCCCGACGCCGCCCGCGGTTGCCCATGGCCGCAG
CAACGTGGGGCGAGGAATTGCGGAATGACGTTTGAGTCAAATATGAGTGCTGAAAGGACGCACGATTGGTTAAAACCTTTTTtgtgagtgatggtcaccC
AATTTTAACCAACCGCCGCATGACATTAGCGAGCAACAACTTTTGAATCTGCAAGATGGCTCTCCTCGATGCGCTCCTGCCCCTCCGCCTGTTCCTGACG
CTCGTGTGGTGGCACATCTGCCACTTTATAGCGCATACATTGCACGTGAAGGGTATTAAACCCTCCAGCCAATTCTTCCAtaaggtggtggtgatcggCG
ACGACTTTGCTGCAGGTATTGGCGACTACATCACGATGGGCAGCGCCGGAGGAGTCGCCGAGTATCTGAAGTCGATCGTGGCGTACAATGACAAAGTACG
TTGATTATAATAATTTGTAAGCTATGCTACATCTTGAGCTCTTAAAATGAGCTCAGCAACCTGCTACAGTAGTTATATCCGTTATTAATAATTACAAAAT
ACTTTTTAACTTGCTGTAGGTTCGCCACAACTGGGCGATCATCAACGCCGGCGTGCCTGGATCCACTACGGCAGATTGGATGATGTCGTCGCCCAAACAG
GTGAATACAGCACTAGTCAACATTAGTAGCCTTACAGTGTGTATGAGCGTGCTTGAGCTCGCTCTGTCATATAACTGCGCTCTAACAAAACAATAATGCT
TTACGAGTTAGTACTTCAAGAATGCGCTTACCTCGAGATCCATGGGTGATGCGTCGATCGTGATCATCATCCTGGGATCCGCGGAGCTCAGGTGGGCAAC
AGCTTGTAAATACTCGAAGAGCTACGCGTTAGAAGCCCCAATAGGCCTAAAGCGAGTGACTGACGTGGTACCAACCGTTGTTGTCTTTGTTCCTGTGGAT
AgaaacccagcagcagccggGCATGAGATGAAGCGCAACCTCATGGAGATTTGCGATACACTGCGGAAGAAGGGTAAGCACGTGTGTCTGGCCACTGTCG
CAAGCCCCGACCCACTTGCCAGTGAGACGGACTGTGCCAGCTCCACACTCAACACTGCACTGGAGCAATTCTGCAAAAGGTATCTGGAAACTCGCTTCCA
CCCATGAGGAAGTGCCCAGTGGTCCTTGAAAGCAGTCAACTAACCGTTGATTGTGTTTGTGGCATCTTGAAAGTACATTAACGGAAGAGGCGCCTGTAAT
TTTTGGCCCTCGTCTCGACAACTATGCGTTTCGCCGTGAAAATGCACTTTCGTACGATAAATACCATTTCAACTCCCAGGTACGAATTTGACATTGCCCG
AAGTTCCAAGCTGTCAATATTGAACCGAGATTTAGCTCACACTCCTGCTCGTGTGGTGGAACCTTTGCTTCATCAGTCGTACCGACTGCTGGCTCGCAAC
ACGGCGGACTTCTTAGTCCCCATGATGACGGCCGAAGAATGGGCCACCTGGAAAGAGCAGCTAAGCCACGTCACGTATGACAAGGCCTTGTACGAGTAAG
GCACAGTGGCGGCCACCGTTGTTGCAGACACCTATAACGGTCCTCTGCATCAAAACCCATTGCCAGCCACACCAGGAAAGAAGACACAAACGACTTTGTA
TCCACTTGTTCCGAGGTTGTCGTGGGTTAGCCGGCTCGATTGCTCTTGTACTTGGGTCGCCCATCACGCAGAAAAGTTAAACAATAACACCACAGGAAAC
ACGCGAGCTCATCTTTTTTCTTTCGATTTCGGTTTTTGGCACGTCCTCGCCACCTCGCCTTCCCACTCTCACGAGGTCCATGCGAGCCGCTCGTCATCTC
ACATGTGATCTTCACAAAGTGTTCAATCCACTCCAACTCTTCGTTTCCATGCCTTCGATCTACATGTCCACGTATTCTCCTTCAATGACTACACACCGCC
ATCGCATCATCAAGACTCCATAGTGGCGTCAGCAGCGGCGTCGTCACCTTCCGTCTTGGTGCTATTTTCGTGCGCTGGCTTCGCAGCCCAGTACGCCTCC
ATCTGACGGTCCAGTTGCGCAGCTTTTGGATCCGGACCTTTCCCAGCTTCATGCCAGTACTCGTCCATCTCCATGTCAAGGTCGTCGCCGGTAGGAGGCT
TCGCCTTGGCGTCACCGCAGCCGCCACTACCGCCACGACCGCCGCGTCCTCctcggccagcagcacctcggccagcagcacctcggccagcagcacctcg
gccagcagcacctcggccagcagcacctcggcCCCCCTTGGCTTCGTTCTGTTGCGCCGTCGGCTTCTTGTTTGCCAGTTTGTTCTGGTTTCCCTTGGGC
TTGGCTTGCTGCGGAGTCAGCCCTTTCCTGTGCTTGCCGACGACCAGCTGGCGCTTGGAGCGGTTGGCttgcacttgttgctgcagcttctgacgttgct
gctgttgctgctgttgctgctggaccTGTTTCTTGGTGGGGGCTGGCGCCTTGTTCTTCTTACCAGGCATGCGGAGCACTGGCTGCTTCTTCTTatgttg
ctgcatctttaCGACTGTgacttggtgctgcttctccgTTGGACGCGGCGTCTCGTCCGTCAAGTGGGTGAAGCGGCTAGACAGAGGGATGGCCGACACG
CCAATCACGGTACgtggcgtcttcttgctttgcTGGTCGATCTTGCGTTGGCCGCGGACGGACGCGCGTGGGGCTCCGGATCTCCGATACATTTCTtcag
ttggtggtgcttgttcCTGCTGGTTGGTGCTTTTTATACTATGAGAAGAAATGGGGTTTTTATCTGGGTTCAAAATGTTGCATGAAGGTAAACTTTTGAA
ATGAATGTCGCACGAACGTGAAACGAAAGACGCCGGATCAAAACTGACCAGACGccacgatggcgatggaggcGGTGCTGGCGAGGCAAGTGCAGCGCTA
TCTGGACGCCTACGTGACTGACAATGCGCGGTTTCTGGCCGAGAGACTTGTTGCGCATGTAATGAACCCTTAATAGCGCGTTTTGGATCGCGGGAAGACG
CATAACATGGATTTATAAGCAATACTAACGATTTTTATGATACATTTTTGTTTCTCTTTGTTTGTTGCTATAGCATCCGACGGAAGA