Description :
From Genome Similarity Track
Location :
Scaffold_11:1195459- 1196697
Sequence
1238 bases(100 bases per row)
TTTCACGAACGTATTGGCGCATTATCTGGTGCTTCATTGTTTTTTTCAACTGCCATTCAATTTCGCTTCGGGGTCTGGATCAGCGCCAGCTCACTGAATA
AACGCTCACATGTTGCCGTGTTAGCGGCAATGGACAATATTGTGAGAGCAAGCAGAGGAAGTTTGCAGTTCTTTTTCGTACTTTTCTCGTACCCCCAAAA
CGTTGACACAGCATCATTGGTGAAGTCAGTAGAACGTGAAGAGGTATAAGTTCCCTGAATCCAAGCGAACATTTCACCGCGTAGCCCACTGTCATCGTCA
TTTACAAAGCGACGAAAGTAATATTGGGCAATTTGACACACATCGTCCTTTTCAGTAATCACCGTTGGTGGTCGACTTCGTGCTTCTACGACATACTCAG
GATGAAGAAAGAACTCTAATATAAAGAGGGGTTGCTCACAGGCATTCCAACGAGCTTCCACTAAATCTGTGAGAGATTCACCCAACTCTGTCGACGCAAA
CCCACGATAGGTATCTATAAAAGAGATAACCACATCGGCTACGGTATTTTCGTCCCTTTGGAGACGAAATGAAGCAGTACACAATGGTCTTACAATTTTC
TCTGCAGTCTCCAACTTTGTCCAGAACTCAGCATCCCCTAAAACTCGAATTTTGTCCGTGAGATCCGGGCTGCTCCGATATGTGAAGGCCATATCTTCTA
AGGCACCGCGTACACGAAGTAGCGAAGCAAAGCAAGCCTGCATAGAGTTCCACCTAGTTTCGCACAGCGTGAAAACAGCAAAACTATCGCCATAGCGCTT
GCTCATTAATTTAGCAGCCCGAACCAGCCACTTAGCAGTAGAAGTGCTCAGAAAACTCGCAACCCCTGCGGCTTGTTCGGAAACCTTTTTGAACGCCGAT
TTTAAAACAGCTTTCACCAGGTTGTTGATATCGTGTGCGAAGCAAGGTATAAAGGCAATATTTGGGAACCGAAGTGCCAATATACGGCGTGCACGGCTAC
ATTGGCCGGCACTGTCAGTCACAACTGCACCTACTTTCCACTCTGATGCCAAAAGCTCGAAAATCACGCCTTCCATCTGCTCGGCAATTGCAAGACCGTC
ATGCCGATCACCAGTAGCTTTGACATCGTAAGTCAAAATCCGTCCAAACAATGCAATAACACATCCCAGTACATGCAGCTTTGCAATAGTTTCCCACACA
TCCGACAAAAAGTTTACCCTCCCGCCACTTCGGTTCTG