Description :
From Genome Similarity Track
Location :
Scaffold_148:119545- 121455
Sequence
1910 bases(100 bases per row)
ACAATCCTGGGAGGCCTTGCGGGAGTCAGCGAATCCCGTATACGATACCGCCTGCGAGTCCGACGTATTCCCGGATGAGATCCCCGCCGAGCTACCGGCG
GATCGTGGGGTTCAGCATGAGATCGACCTCGCGCCAGGTACGAAATACTGCGTCACCAGACAATGACCACTTCCTCGTGATCAAGTGAAAGCGATCGATG
ACTTCTTCGAGGGCCGCCGAAAGGCGGGTCACGTGCGTGAGAGTACCTCTCCCCATTTCAGTCCACCGTTCTGTATGAAGAAAGCTACAGAGGGGTGACG
TATTGTTCACGCATTCAGCAAGTTGTATGATGCCACCATCCCCGCGCAGACTCCGATCCCTCGGAAGGACATGGTACTTGACGCCATGGCTGGCAGCTTC
ATCTACAGCGCCATCGACCTGACCGATGGATTCTTTCAGATCCTGATGAGAGCATTTGATGTGCCTCTCACCGCCGTAATTACACCGAGCGGGATGCTCG
GGTCGTGGCTCGTAATGCCACAGGGTCTGAAGAACGCGCCTGCCACCTTCAATCGCATGGTCTCCCATGTGCTTCGCCCGCTTCGAGACTTCGCGCCGAG
TTACTTCGACGACATCTTCGTGCACAGCCGCGCTGAGGGCAACCTTAGTGCCGTGGAAGTACATCTGAAACACCTGAGACAAGTCTTCCAGGTGATGCGA
GAGAACAAGCTCTACGCAAACCTGAAGAAATGTGTCTTCTGCGCACCGGAGATTCCGGTGTTGGGATGCTACGTGAGCAAGTAAGGTGTGCTCGCGGATC
CCGAGAAGGTATCGTCTATCTGTGCTTGGCCAACGCCGACAAGCCCCACTGAGTTGCGTCAGTGGCTTGGCATGGCCAATTACTTGCACAAGTACACGAA
GAATTACGCTGGGTTGATCCAGCCGCTGTCCTCGCTGCTGAAGAAGGACGTGATCTGGGAGTGGAATCCGGACCACCAAGCTACATTCGACTAGGTGAAG
AGGAGCTTGGCGTCTGCGCCGATCCTAAAGCTCGCTGATGACTCAAAGCCATTCCACGTCGTCTGCGACGCGAGCGATTTTGCCATCGGCTGTGCGCTGA
TGCAGTTCGATGATGACGAGCATGAACGCGTTATCAGCTATCAGTCGCGTCAGCTGAAGCCAGCCGAGAAGAATTACCCAGTCCACGACAAGGAGCTCCT
GGCAATGCGGTACGCTCTGATCAAATTCAGAGTGTACTTGCTCGGTGAACAGTCGTTTGCGGTATACACTGATCACGCATCGCTGCGGACAGCGATGAAG
AGCCCTCACTTGTCGCAACGGATGGCCCGTTGGCTGTCCTTCTTCTCCGAGTACAGCTTCGTTGTTCACTACTAGCCGGGCAAGAATAACATTCTCGCCG
ACGCGCTGTCTCGGCGTCCGGACTACGATCCCCGTGAGGCGCTAGAACATCAGCTGGCTGATGAGGACGACGACGAATGTGCGGTCTGCGTGTCGTCAGG
CATCAACTTGACGTTGACCACGCCCACGCTCCCGCTGGGCGACGAGATTGCTACAGCGTACGATGATGACCCTATATACGGGGCCATCATGAAGCACCTG
TGTGCTCCTAGTAGTGACACGTTAAGTGCCCTGTCAAGGTCCACGCGGAATCAGATCGATCGATATCGACTGGACGGCAATCTGCTCAAGTACAGCATCG
ACAGGTTCGATGGACCTCGAGTCGTCGTCCCAAACGACTCTGATCTATGCGCGCGCATAATCCACGAGTATCATGACGCCCCGACTGGAGGATATCTCGG
TCGCGAGAAGACGTACGCGGCTGTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGATACGCAAGGGTGGTCCGTACATGTGAAACTTGCCAGCGAG
TCAAACCGTC