Description :
From Genome Similarity Track
Location :
Scaffold_3001:1195- 2693
Sequence
1498 bases(100 bases per row)
CCGTTCACATAGAACGAAGTGTAGCCTGTCGAGGCGTGCACTGCATTACTTAATGCGAACTCAACGAGTGGGAGCATCTGGCTCCAGCGTTTTGGCGCCT
CAGCGCATACGCTTCGGAGGGTATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGCGGATGGTTCGCTGTGGACATGTCCAAACGAGT
GCCGAGCACTCTGAAGAGGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGGCAAGCCATGTTGGCGAAAGACTCG
GTCTAAAAACAGCAAAGCTGTACCTTCACCATCAATGGTGTCCGGCACTGCCGCTAAATGAGCCATCTTGCTCAATCGGTCTACAAAGACCACTATACCC
GTGTTTCCCGCCTAATCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAGCATCCCTTGGGGACAGGCAAACTCGCCAATGGCTCTGCCG
TGCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACATCTTGGGTCACTAGTACATCGAGCTCACCGA
GCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCGTAAAGGATTCGATACTTTAGATCCTCATCATGAAAAAAGACTACA
CGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAG
AGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCCCCGCGTATCAAGTCAGGCACTGACGACGTCAC
TGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCG
GCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAACGCTTAG
AGCCTAGCAGGTGTACCCTGAAATTGACTAGAGCATACTTCATTGCAAGTAGCTCTCTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCG
AGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGA
CTATCCGGGTCCGGTAGCGCAAGGATTGGAGCCTGGAGGAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCAACGTTCCAGCACCATGGTGCGT
CGATCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTCGCGCTGTACTGTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCATAAGTC