Description :
From Genome Similarity Track
Location :
Scaffold_4:1194988- 1196769
Sequence
1781 bases(100 bases per row)
GTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCCGCCAATAACAGGCGTCGAGGTGAAAATAGCATGTCGACGCTGCAGGCGGTGCGGACG
GTTGCAAACATTCCGCACCGGAAAAACTTGCATGCTGTCGTTCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCC
GCGGGATAAACCGGCCGGCGGTACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAGTCTTGCGGAGCCGGGCTCCGCAGGATAAGA
AGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTACCGGGCAGACGGAGGCTGAGAAGCCGGACGTCG
AGACGTTGAACGTCTTGACGCGTACCTGCGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCC
AGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGAACGCATCGAGCAGATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAA
GAACTGAGGCAGTTCTTCATGGAGAACACCACTGAGAGCGAAGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAAAGCTGGGACTCGT
TGAAGACGAGTCCCTACTACGAGGTCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACATGGGAATTCAGCACGA
GATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAATCGTCGC
AAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCATACAACA
AGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCT
GCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCAGTGAGCACGCCGAGCGGCATGTTCTGGGAGTGGCTGGTGATGCCG
CAAGGGCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTTTGCGCTCGGTGCGCGACTTCGCACCGATCTACTTCGACGATGTGTTCGT
CCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGTTTGCGCTCATGCGCAACCACAAGCTCTATGCGAAG
CTGAAGAAGTGCCTCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCA
ATGAGTGGCCGACACCGTCGAACGTCAAGGAACTGTGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACG
CCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCCTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCTG
ATCTTGGCGGTGGCCGACCAAGATCGCCCGTTCCACGTGGTGTGTGACGCATCCGACTTCGCAATGGTACATCTTGCTGCA