Description :
From Genome Similarity Track
Location :
Scaffold_349:11949- 13089
Sequence
1140 bases(100 bases per row)
CTTTTGCATAATTGCACAGCCGATAGTTAAATTACTCCCATCGCAGACAACGCTAAAGGGATTATACGCGTCTGGCAAATCCAAGACCAGAGCATCTACA
ATTGATTGCTTTACTGAAGTGAAAGCATTTACTTAAGCTTCAGACCAATTTCACTCTGTGTCCTTTTTTTTAAAACGATCAGACGTAGGTTCGGTTCGCT
CTGCATTATTATTGCTGTATTTATACAAGCAATTGGCAAGCCCGAGGAATTGACGCACATCCTTCACATGTCGTGGACAGGCCATTCCTTTATAGCTGTA
ATTTTTCCTGAATCTGCTCTGACACCGTGTTTTCCCACGATGCATCCTAGTACAGGTATTTCGGGGACCCCTAAGACTCACTTGTGCAACTTGACGTACG
ATTGGGTGTCACCTAGAGTCTGCAACACAACCTCCAAATGCCATTTGTGCAATTCCATCTCACTCAATCCGTCCTCGGCCCTACTATGGTCGAATACATC
GTCAAAGTAATGAGGAACACATCGTCAAAGTAATTAGGTGCGTAACCACGCATCACATGAGATACCACCTGGTTGAATGCCACTGGTGCGTTTTTCAACT
CTTGTGGCATCACTAGCCCCCCCCACAGTATACTGCTGAGGGTGATAACTGCCGTATTAGCTACATTGCTCTCATTCATGAGTACCTGATAGTAGACATA
CGTCCAATGTAATGCGGAAACGATAGTTGAATACTTCATTAAGTTCAAAAGGTAATCTATCCGCGGGATCGGTGTTTGCGCAAGGATGGTGGTCTTGTTC
AACTTTTTGTAAGCATGAACTACACGACAATTGCCTGTTGCTTTACGCACACAGAAGTTCAGGCTGCAGTGGGGCGACTTGGTTTCACGTACATGTCCCG
CCTTGAATCGCTTGTCGAAGAATTGGTCGATGGAGTCGACCTATTCCTTCGGCAATAGCCACTACCTGGTCACATAGTACTTGGTTCCATGTTCTAAGTC
AATATCGTGCCTGATACCCCTATCGGCCGGTAGGCGGTTCGGGAATTCTGAAGGAAAGACACCACGGTGCTTCCACAGAACTTTGTACAACGGTGTGCTT
TCTGGGCGTCCTATCCTTGAGCAGAAAATTGTTTAGTCTT