Description :
From Genome Similarity Track
Location :
Scaffold_410:11948- 15231
Transcript NameFunction/comments
Phyta_totarag8036U4/U6 small nuclear ribonucleoprotein Prp31
Phyta_totarag8037hypothetical protein PHYSODRAFT_293746

Sequence
3283 bases(100 bases per row)
AACTGCCGACGCAGAggcagaagacgacgatgacgccgacGAACAGATGCTCGAGGCCTCCGCCGTCGCCCAGTCGAGAGCAGCCAAGCGGAAGCGTCTG
GACACGGAGCAGGCGCCGACGGGGGAGAAGGTCGTGGACTTCGCTGAGTCGCTGCGCTCCAGCGTCAAGCAGCGCGGCGTGGCGGCCGTCGCGTCGCTCA
AGCGCTCGACCAAGTACCTGGCACACGTGCAGCAGATCCAAcagcacgtggacgacgccaccgcGTCAGCCAAGCcccagcagctggaggaaggCAGCGC
CGAGTACGACTTGGTGGTGACGTCCAACGACCTGATGGtgcagatcgacgacgaggttgAGGCCGTGCACCGCTTCATCGCCGAGATCTACGCCGCCAAG
TTCCCCGAGCTCGACTCCCTTGTGCCTAATGCACTGGACTTCGCTCGTGTCGTCAAAGCTATTGGCAATGAAACGGACCtgacgctcgtggaggagctgc
ccAAATTGCTGCCGAGCTCGGCGGTCATTGGAATCTCCGTGACAGGTTCAGGTACCAGTGGCAAACCGTTGGGTCCTGAAGACCTGAAGACATGCATGGA
AGCTTGCGACGAGCTGttgtcgctggagaaggacaagatcaTGATTCTGCGCTTCGTGGAGAGTCGCATGAAGTACTTGGCACCGAATGTGTCGCAACTG
GTGGGCACACGTATTGCGGCGCAGCTTATGGGACTTGCTGGAGGCGTGGCGCAACTTGCGCGAATCCCGTCGTGCAACTTGCAAGTGCTGGgacaggaga
agaaggtgctgagCGGATTCtcgtcagctgctgcgctgaAGCATACGGGAGTCCTGTACTTTAGTGACCTCGTGCAGAGTGTGCCTCCGTATTTACGAAT
GAAGGCGTGCCGAGCTGTAGCCGGCAAGCTAGCGCTCATGGCGCGCGTGGATAGCCAGCCACACCAGAATGACACGGAAGGCCTAGTGGGTGCGCGCTTC
CGTACTGAGCTCGTTGGGAAGGTGGAGAAATGGCAAGAGCcgcagaaggccaagacgaagaaggcgctgccTATCCCAGACGAAAAACCGCGCCGCAAAC
GTGGTGGCAAGCGCTACCGCAAGATAAAGGAGCGGCTGCAGATGACAGATGTGCGGCGTGAAATGAACCGACAGTCGTTTGCTACGGCCGACGAAGAATA
TGGTGACAACGCCATGGGGATTACATCCGGCCGTCTTGGACAGGAAGGATCGGGCAATTTGCGTATCATGcgcaaggagcagaagcagtcgaGCAAAAAG
TTGCGCGCTGCGAACTTTGCCGCGTCTTCTGCTAGCAAGCCGCCGCTTTCTGGGTTGGCGTCATCTCTTGCTTTCACCCCCGTGCAGGGCATAGAGCTCA
TGAATCCCGAAGCTGCGAAGGCTCGCGTCGCCGAGGCTAACAAGAAATATTTCTCTGCTGGTAGTGGATTCGTCAGTGTTGTCAAAAAGCCATGAACTGT
ATCGAAGCGAGGTTTGAACCGCAGATTGGTTTATATTGGTGCTAGCGACGTAAAAAGTGATAAACAGTCCAAAAAAGCTGGCATTTTGATCGATGTACTT
TACTTTAAAAAGTAAGTGTTATCGTTGTGATTCTGAGCTCATCATGCTCAATACTAACGGTAGCTTTATTTACATTTACGTCTTGAGCAACCGTAATAGC
CGCTCATCTGCGAATACGAGGGCAAAGACCAGATTTCGTCGAGATGATCTTTGATTGAGTTAGTCTAACATGTATTCGCAAAAGAGAATTTGTTGTGAAT
TTTTGTTTACCAGATTGAGATTACAGGTAGTTTACAGCATTCACAAAAGGTAATACGTtacacaaacacaacaacaaaaatcaTATCCACACATGTACCG
AGTAAATGGCGTAAAGTACAAGTAGAACTTCTACGTGAATGTCTTCGCAGTAGAAAGAATGTCAACTGATTGCTACAAAGCGTTCGTTTACCGAATAAAA
TTCAATAGAAACTGCATGTCCTCATCACGCAAGACCACTCTCCCTGCAGCGCAGGACAGAGTCCTTCAAAGTGCAGGAGGCACCTATACGGTGACTGTGT
CCGTCAATTCAGCGCCTTTTATCTCAAGCGTCATGATTAATTGAGCTGGAAGATCTACCCTGAACCTGGCACTTTGCCCAAAAACGATGTCAAGACTGGA
GCCCTTGTATACAGCTCCCGCGGTCGCGTTGGGCTCGGTTGTCCAAGTATTGATTGGGCCCTCCACATAAGCTAGAGCCGATAAGTCGAACGTAATTGTT
TGTGCATCTCCCAAGTTCGTAGCCACGATCACCATCAATAGAGTAGCTTTATCGTATGCAACGACAAAGTTCGGGTACTTGTCCAGAGCATACGACGACG
ATCCAGGAATAAGAGTGTTCGGGTCGTCAAACTTGAGGATTGCCATGCCAGCACGGATATGACGCGAGTAGTGAGCCATCACGTAGTGCTTCGGGTTGGC
TGTGCCAATCCACTTGTCGCCAGGGTTCGACTGAATGAGCCCCACTACGCCATAATCTAGTGCTTGTCTGTACACGAAGGCCGATGCGCCCATCTCGTTG
ATATCTCGAGCAATCGTTTCTGCCATAGTGAGTCCAGTGCCATCTTCATCGGCATACATGGAATCCCAAATCACCTTAGGCTTAGCCAAAGTCATCGCAA
AAGCTTTTAGCTTGTCACGACTATCACCTGTATAGGGAGCCAGGCCATCAGAGCCGTGAGAGTTTACCTTGCCAATGGCATCAATTCCAGGTAATTTTTC
CTGTGCCATTTGAACAAGGAGATCCAGTGACTCATCCGTGTTCTTCTCTTCGGCACCCGCAATAACCACACTCTGGAGATCGACTTTGTCCAACTGAGTT
CGCAACAACGTGAAAATTGCACTCTGCGTCTTGATTCCCAAATGACAAGCCTCTTGAGACTCTGGGAATTCCCAAGCCTTGCTATTGGCTTCATTATATG
GCGCGATGTACTTGAACTCGATGCCCCAGTCTACCTTCGCCTTGCTCACCACCGTTGCCAAGTAGACCGCGAACTGTTCGTAGTATTCAGTCTGCAGATT
GTCAGCCGCACCGTTGTCTCCACCAGAGGTAGCGTGGTTGCTCGTCATCCACCACGGTGGTGAGTTCGAGTACGCCTCGAAAACGTCAGCACCTCGCTTC
GATGCAAATCCGAGCATTGCGTGCTGCTTCGCATCCACGTCCCAATTCCAGCTCTTGGACGTCGGGTCCGTGCTGGTCCAGTC