Description :
From Genome Similarity Track
Location :
Scaffold_116:119469- 124134
Transcript NameFunction/comments
g11650.t1ETI34642.1 hypothetical protein F443_18889 [Phytophthora parasitica P1569

Sequence
4665 bases(100 bases per row)
CAACTTAATCTCTCAATCACAACTCAATTTCTCCTCTTCCTCGCAAGTCTTCTTTCCAGCAGGCCAGGTTATGAGCCCAACGCAAGTCTCGCCCACCGAC
GACCGTGACTTCCCGCGCCTCAACGGCCGGAACTTCGTGATCTGGAAGACACGTGCCACCGCCGCACTCGAAGGCAAGAACCTCATCGGCTTCGTCACTC
AAGCCGACTACGCGAGGGAGTCTGAATCCGACTTCAGCGACGACGATGAGCTCGATCCCAAGTACTCCAAGTTCTTCACGGCTGAGGACAACCAGGCTGT
CAAGAAGACCTTGGACGAGATCGGCGCTCCAAGTGCAGATGCACCCAGCTCCTCATCGAGTGAAGCCTCGGACGACAGCACCGCTGTGGCCAATGAAGAT
GAAGACGGAGACGTTGAGATGGACCAGGAGAATCTCCCTAGTCCTTCACTGCCAAGAAGCAGCTGGACCGTCAGAAAGCAGAGAGGCTAAGGGTCAGACG
CCCCAAGCTGAGCTCCAAGACGCTACGCCGGATGGAAGCGAAAGCTAAGGCGTTTCTCATGAAGACCATTGACGACCAACATGTCCTCACGATCAAGGCG
AAAAAGACGCCGTACGAGATCTTCACGACTCTGTGTGCCATGTACGAGGGCACTGCCATCCACGGAGACCCGTACTACATCATGAACTATCTGGTGGCTC
TGAAGAACGAAGAAGTCACCGATCTCAACAAGTTCATCTACGAGATGGAAGAGGGAATGAAGGCAGCCTCCGACACCACCAACAGCGTGATGACAGATGA
ACAAAAGACCATCTACCTGTACCACGCCTTACCTGATGTCTGGAAAGTGGAGATGGCAGCTTGGAAGGGCAGTCGCAAGTATGTCCCATACGAGGAACTC
AAGCGGCACATTGAAACCAAGGTCCGCAACGAGATGGCGCGCAGTAGCTACACTCTAAAACAAGGGACCCCAGAATCTCGGGAGACTCAAGCTGAAAAGG
CCCTGCAAGCTGAAGCGCCAGCCAAAGTGGAAACACCACCGAAGAAGGTGACAGCTCTTGTGACGACTCGCAAGTGCTCGTACTGTGGACGCAATAACCA
CGACACGGTTGACTGCTATATTCTGCAGCGTCATACCCAAAGCGGCCAAGTCAAGGAGGGAACCATCCTACCAGCCAATTTCAAACTGAAACCTCTTCAA
GGAACGCAACGCCAGCATCCTTACAAGGGAGACTACAAGGATCGCGGTGGAGACCGCCATCCTCGCAGCCGCCACAACAATGGCCGCGGAAACGACAACC
ACAACGAGAACGACAGACGCCACAACAATCGTGGACGCCCCGATCGCCATGGCCATCAAAGCTTCAACAAGTTTCGCGGAAGGCGCAACCAAAAAGGCAA
CGGCTCTGACGGGAGCGAGTATGGCATCATTGCTATCACCACGCTTGATCTGACTCCGATGAAGAACGAGATCAGCCTAACGGCTCAAGATGTGCCCCAT
GACCCCGCGTGGACGATCGACTCTCGTTGTACCCGCCACGTCACGTCCAGTCCGCACTGGTTCGAGGACTTGAAACCCATCATTGGTAAAACCATCACTG
TTGGTGGAAACCACCAGATCCCAATTCTAGGCACGGGCACTGTGAACATGACTGTCACCGACACCAAGGGAAGCAAGCGCATCATTTCACTGAGCGACGT
GCTCTACTCACCCGAACGCAAGTTCAATTTGCTCTCGGTGCGCCAACCTGTTGATGGAGACTACAAGATCAACTTCCCCAACGCCAAGAAATGCGTTCTG
TTCTACGCTCACCGTACCAAATTCGAGGCCAAGACTGGAGAAGGAACCAATCTGTACCACTTCAAGGCTTTCCCAACTGATAGTGACCAAGCGACCCACG
TGGCCAACACAGGTATGTCCGATAACATCATGTTCTGGCACAGACGAGTGGGGCATCCTAACTTTCACATTATGCAGGATCTGGCTAAGACCAACAAAGT
TAAGGACATGGGACTGTCGAGATTCGACTCCAGCAAAGAATGCTTCTGTTCATTATGCACATACGCAAAGTCGCACCGTAACCCGTTCAATAAACGATCC
GTTGAAAGGGCGAAATTCCCTCTTGAAAAGGTCCATACCGATATGGCTGGATCATTGTCAGTTGCAATACTCTCGGGCTGCCATTACTTTCTCACTTTCA
TCGATGACTATTCACGCTATATGTTTATCTACATCACCAAGCGGAAGTCAGACCTCTACGAATGCTATGAGAACTTCAGAAAGAAAGCTCGCAACATGTT
TCGCGCTGACGTAGGCCAGCTCGAGTACATCGAGAAAATGTGCGATGAAGAGATCCGTCACCTCCAAAGCGACAACGCCCGAGAATACGAAAAGCTCGGT
CGAATCATCTTTGAGAAATACAACACACGCGCCCAATTCACGAATGCCTACACCCCTCAGCAAAATGGGGTCGCAGAGAGAAGGATGCGCACACTACTTG
AACGAACACGAGCCTTCTTAATTGATGGGAACTTACCACACGTTCTCTGGGGAGAATGCGTGAAACATGTCATCGATCTCCTGAACATCACTCCAAGTTC
TGTTACGGACAATATCACTCCTCACGAAAAGTGGTTCAAGCGCAAACCATCCGCACACTACATCAAAGTCTTTGGGTGCGCGGCATATGCGCACATTCCA
GAACTCTATCGGACCAAACTCGAAAAACGAGCAAAGAAGTGCATATATCTAGGTATTCCGTCGAATAAGAAGGGGTACAGACTTCTCGACACGACCGAAA
ATCGGATCATCTACAGTAGGGATGTTCAGTTCCGAGAACAGGAATTTCCTAAGATAGAGTTTCTTCAATCTCCAACCACGGGAGACCTACTCAGACCTAG
CGCTGAAACCACACCACCCACACCACAACCACTACCATCTCTCGTTGAAATGCTCAAACGCAGCACGACAGCACTTGCAGCTGACAACAGCAAAGGTTCG
AACAAAAAGGCAAAACATGTCCAAGAACACACAGATCTAATACACCTCCTCAATGATCCACTCGATGTGGAGGAACGACGAGCGCTGGAGGAACAAACGT
ACTCATTGCTGGCGATCCGACACATTTCGGAACCAAAGACATACCGAGAAGCAATGCGTCTACCCGAAGCACTCCAGTGGAAAAGTGCCGCACGCGCCGA
GTATAAGTCACTGATGGAAACAAAACGTGGCTACTCACAAAACTACTCAAAGGAAGACGAGCCTTACAGTGCCGATGGGTGTTTGTTGTCAAATACAAAG
GCGATGGCACGATCGATCGCTACAAAGCACGACTTGTGATTAAAGGATTCCTTTAAAAATACGGTATTGATTATGACGAAATCTTTTCACCCGTTATCCC
CATGGAAGTCCTCCGGCTACTACTCACCATAGCAGCTCTTCTTGACCTTGAGATCCATCAAATGGATGTCAAAACGGCTTTCCTAAATGGATTCCTCGAC
GAAGATATTTACATGGAGCAACCCGAAGGTTTTGCCACTCGAGGGAAAGGACATTTGGTATGTAAACTACTGAAGAGTCTTTACGGTCTCAAACAAGCAC
CTCGGATTTGGTACCTTACACTATGTACTTTTCTGGTAACCATGAAATTCCGCAAACACTCCAAAGACCAATGCGTTTTCGTTGGAGAAGTCGATGGACA
TACGTGCTACATCCTGTCTACGTTGATGACCTTCTTATCATTGCGCCTACGGTTGCTATCGTTACCTCCATTAAGGGCGCGCTCAAAAACGCTTCAAAAT
GTCTGACCTTGGCGAAGCTAAGTATCTCCTCGGTTGGTCGATCGTCCGAGACCGGAAAAACAGATCCATCTTTATCCACCAGGAGAAGTACGCTACCAAG
GTACTGGACCGCTTCTCTCATCTGAGCTCCTACCCCGTCGGTACACCAACCGATTCGAGTATCAAACTCTCACTTAACATGTGCCCTGCAACGCAGGCGG
AGAAGGATGAGATGTCTGCGATCCCGTACAGAGAGGCAGTCGGTAGCTTCATGTATTTGATGATGGGAACTAGACCAGACCTAGCTTACTTCCTTCGAGA
AGTCAGTCAATTCCTCGCAAATCCAGGTAAAACACATTGGAATGCGGTCAAGAGAGGCCTAAAATATCTCAATGGCACCCGCAACTTCGGTATTATATCC
AAAATGTTGATCTTTATAAAACGCAGCACTACCTCTCAGCCTTTTCAGATGCGGACTACGCCAACTGCCCCGATACACGTCGATCGGTAGGCGGATACAT
CACATACATGTGTGGAAGCCCTATATCGTGGCAATCCAGAAAACATCACACAGTCGTGCTCTCCACAACGGAGGCAGAATACATCGCTTTATGCCACTGC
ATACAGGAAGTGATCTTCCTCAATATCTTGCTTACAGAAATAAACCACACCAGTCCTCATGCAATCATCAAATATGAGGACAACCAAAGCTGTATCAAGC
TCTCATACAACCCCGAATTGCATGGCAGATCGAAACATATTCACATTAGATACGCCTTTGTACAAGAGAAAGTAGAGAGAAAGGAATTCTCGATACAGTA
CTGCAATACCAAAGAAATGGTAGCTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGT