Description :
From Genome Similarity Track
Location :
Scaffold_161:11946- 18882
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_161-abinit-gene-0.27Adenylate kinase domain-containing protein 1
Pytve_DAOMBR484maker-pve_contig_161-snap-gene-0.21Protein kinase
Pytve_DAOMBR484maker-pve_contig_161-snap-gene-0.14Leucine rich repeat containing 45

Sequence
6936 bases(100 bases per row)
GTCTCGTGGTGGCACGTGGCGATTGTGGGATGAACTTGGTCGGGTCGCGAGTGAACGCACGGAGTTCCTGGTCGCCCGCAAAAGCGTACAGCTGCTGCTT
GACGCTGGACACGAAGGCAACGCGGCCAGGCACTAATGTGTGATGGGTGGCCCATGACACAGCACAGTATCGCCCGGTCTCACCCAATAGCCACGATGCA
TCGGCATGGCCGTCGCCTAGCCACGCACTGTCCGGAGTATCGCTGTCGGTGGAGGCTGCGATCTGCGGTGGAGCGTGACCATCTTTGTGGTTGTCAACAC
GAAGAGCGAAAGGATCGAGCGCTGAGCGGACAGCTGCCACGACTGCTTCGTCGCCGCCAGTCAACGAGACATTGACGCGATGGAGCTTGACACCGAGCGG
CGTCAACAGCTCCTCTGCAGCACCAAGCTGTGCTGTGAACACCTCGACACGTTTGGCGGCAAGATTGTCCCCCTCAGGAGGCTGGCTGTAGCCTTCGAGC
GCCACGATAACTTCAGGGAGGCTTGTGTTTGACTCGAGCACATTGAGAACCTCGGACGAGAGTGGCAGGTCCGCCAACAACCAGGAGGATCCAGCACTCA
AACCTCCGCTGACGAACAGACTCGCCGTGGCGTCGGCAGCCGATATTACACCGCCCCTCGCTAGCGCTGACCGATGATTATCACCGGTAAGTAGTTTCAT
CGGCGATACCACCGGGAGACCGAGCGCTTCGGAGATTGTCGAAGAGATCTTGAGATCGTTTGGTAGTTTCGGGCTTAGCAGCCAAACGCGCGTCACTGGC
GGGGCTTGTGGCTTGCGGCGCAGGTACTGAAGCGGGTGAGCGATGAAGATGGAGCGTGCTGCCGCCGACGCCAGCAGATAAACGCGACCAGCCATGACGG
CAGCGAAAGCCGGGCTACCGAGTTCAAGTCGCACACCGAGGTCCGAGGTCACAGGGCAAAACTCACGCCAACGTGAGAGCCGTCTGTGCGAGGCATGGCG
TCTAGGGAGGCGAGCAAAGGAGTCGACTGAGTCGGCTTTGTCTTCAGCGGCCAGCAGACTCACCCAGTCCCCGAAAAGCAGCCAGCGAAGCTGCTCAGCG
CGGGGAGCGGACGCCACCTCCTCGGGCAACGCGATGGGGACGGCGGCGTGTGAGTATACAGTGCGCGACACGCCTAGTGAGGTCTGCGCATCGAACAACA
TTCCATTAGATCAATGTTGAAAAAAGTGATGCGAAAAAACACCGGTACGAACCCCGCACATGACTTCAACGCACTGGTTGACACTCGAGGCGAGAGCTTG
GCCGGCGAGAATAGCTACCTCGTGCCATTTCGGTGGTGCTGACAGTGTCATTGTCTTGATGGACGCTCGCCACTCGCAATAGCCGTGGATGCGTGTGGCG
AAGTACTCGATTGTGAGCGACTGGAACGGCACGACAGGCTCCGCAAGCGGTGGGACGCCGTTCCTCTCAGCTGGGGTCGGTGGTGATAGCGGAGGAGGTG
GGCGATCTTGTCCTTCGTCCTCGGTTGATGTCAGTTCGGCAGTATCGCCTTCGCTGTCGTCGGGGATGCGGGGACTCGTGACCACCTCAGCCGGTTTGTT
TTCTCCGGCTTGGTTGTCTGTTTGAGGTTCAGCGTCAGCGAAACCCACCGCTGCAAGCTGTTTGAGAGAAGACGATGCTTTTGCCATCGCCAGATCACGC
GAGGAGTACACGATCCGACCGGCAGGTGCAATCATGAGCCCTGCAGCTCGTTCTGCCAAATCGGTCTTCGGCGCACGCAGCGCAACGACAAAGTCGACGC
CAACGGCCGATGCCAACTCCGCTGGATGGACGTCGTCCAGCACGACGCCAACGCCCTCTGCTCATCAACATTGTCAATATCCGAGGCAAACATCAGCAGT
GCATTGGACACAGAAGCATACCGAGGAGCGAGGCGGTCGCGACATGGATGAGAAGAGTGAGCGAGGTCGTCCTTGAGAGCGTGAGTCCCGAACGAAGTCG
AAGGACGTCGCCTTCGTTCAGGAGTGCCGCGAGTGGCTCGTCCTCATCTGGAGCCGCTGGAGCAGGCTCTGGAATTGTCTCCACTTGGTCTCCCACTGGT
GGTTCGGCCGCTTCCTCTGTTGCCTCAGTGGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCTCAGCAGCAGCCGCCTTAGCCGCCGCGGCCTCAGCGG
CAGCAGCAGCAGCAATATCCTGACGCTCTTTCCGTCGTCGAAACGCCGCCAACGCGAGTTGGATGGCCACCGGGAGTGACAAGTACCGCAGACCGAGCCG
CGCTGCCAGGAGTTTGGCGAGTCGCGTCTTGCCGCTCAGCGGCGGTCCNNNNNNNNNNGCCGCGCCGGGAACTTCTCGAGCGACGCTATGAACGCGAACT
CCGAGTCCCACGAGTCCTCACTCTGGACGTTGAGAATCGCAGGCGAGGACGATGGGATGGTTCGCTGCTCGTCGTCGATGTCCAGCTCGTCCTTGGCGCT
GTCCGTATCGTCCAGTGGCGGCAACACTGCTGCTTGNNNNNNNNNNTCGGTCACCGAGGCGAGCGTCGCCATGGCTCGCGACAGTGCGAGCTTGCGTGGG
TTGTAGGCCAGCAGCAACTGCTTGAGCGACATGGCGCGTGCGTCCGGCGGTGCGAGGCCGCTCACATTGGCGAGCTGGTCGTGTCCTGGCGGATCAGACT
GGAGAAATGCACCGCGGATCTTCTTGACCGCCTTGAGCGGCCGCAGCACATACCGCACGGCCTCGAAGACTTGCGGCACGGACAATGATGCTTCGAGCGT
CAAGTCCGGGCTTGAAACCTGCTGATCCCGCTCGAGGTCGCCGAGCGAGGCGAGGTCCTTTGGCTCGGCGATCGATTCGCGCAGCTCGAGGAAGAAGGAC
GCGATCATGGACGAGTCGCTCTCGACGGGCAACACCAGCTCCGCCACCTCCATCAGCGCCTCGCGGAACAGCTCCATGGTCAAGCACGCGCAGCCGTCTG
CGCCGTCCACGGGTCGTCGACAGCTCTCGCCGTGGCTGTCGTAGAGCCAGTCGCGCGCCGCGACCTTGGCGGCCTCGCTGGCGTTGACGGACCGCACGAG
CGCCGTGGCCGCGCAGGCGAAGAACGCGACGTACTCGCTTCGCGAGAGCACATTGCGGTTCGCGGGCGTGGCCAGCGACCAGAAGAAGCCCAGATGTCTC
GCCACGGCGTCGGTGGCCGCCAGCGCCTCGCGACGAACCAGCCACGCGCGCAGCAGACTCGTCGAGCTGGAGGCGGAGGCCGGCGTGTCGCCCACGCTCG
GCTCGCGCTTGTCCTCACCCGGGAAGACAAAGTGCCGCCGCATGTCGTGGCGCGGATGCCGAATGGCCAAAGCTCACGGACACGGGCGGCGGTTGCCACC
GCAGTCGGCGACCAGTCACCGCGAGGGTGAGTGAGTGAGTGTATCAATAGGGGCAGAGTCTTCAAGTTGAAGTGGATTTGAATTGGAATGGCTAGTATAC
TTTTGTTCATATTAATAGGGAAAGCGCATCATCAAATGCGCAGCCACCGCTCAGGCGACGGCGGTGGCGGCGCGGTCGCAGTCCCTGGCCGCGGCGGACG
GCCGAGCGATGGCCACCCGCGTGTCCACGAGAGCGATCTCGGCGCTGTGGGTTCGGACGCGGCCGGCTTTCTCGACGTGGGCCGTCGTGTGACGGTCATT
GCGCTTGGCGACCTGCTGAGCAGTCTCCAGCCTGTGCACGGGGAGCGAGCGCCGCCGCGTGGACAGCGTCTTGGGGATGGCGAGGCGGTTCGTCGGGCGG
CCGGAAATCGGCTCGAGCGTCCGTGCGGCCGCCACCTGGCGAGNNNNNNNNNNNNNNNNNNNNNNGTCCGACAGCCACGGGTGACGCAGTGCCGCCGTGA
CCGACATCCGCGTGGTCGGGTTCACGTCCAGCAGGCGGCTGAGCAGGTCCACGAGCCCCGCGGGAGCGTCCACGAGCAGCTCTACCGGCGACGACTGCAG
CACGCGGCGCGCGCCGTGGGCCGCCAGCTCGCGGAAGACGGCGTCCTGGTCCGTGGCGATCCCGACGAGCGGCCGCTTGGCGCACAGCGCGTAGAGGATG
ACGCCGAGAGCCCACGCGTCCACCTTGAGCAGGTCAATGTCCCCCACGTCGGCATGCATCTCGGGAGCAGCAAACGCCTGCTTGGCGATCGACACGTCGC
GGACGTCCACTGTCTTGTTGTGGACGCGCACGGCGTGGCCGAGGTCCGCGACTTTGACGACGCCGCTGTCGGTGAGCAGCACGTTCTCGAGCGACAAGTC
CATGTGCGCGATCCCGGCGCTGTGCAGCTCGGCAACGCCGCGCACGGCCTGTCGGAAGAGCGTGCGCACGCCGGCGGCGCAGGTCGTGAGTCCTTCCTTG
GCCGACAGCAATCCAGCCTGGGTCATGCGCTGCTCGCGTCGCACGAGTCGCCAGAGATCGCCGCGCGCACAGAACTCCTGCAGCAGGTGCAGCCGCTCGC
CGACGAGCGCGTAGCCCTCGAGGCGCACCACGTGGGTCTGCGCGCCGAGCGCGAGCATCAGGTCGAGCTCGCGAAAGGCCGAAGCCGCGCGGACCCTCCC
TGGACCGCGCGGGTCGGCCACGTGCACGTGCTTGTCCACGAGCATGCGCCGCGAGGCCGCGCACTCGACCACGTCCACGCACTGCGCGCCGCCGTCGCGC
TCGTGCAGCCGGAAGCGAAAGCGCGGGACGTCCGCGAGCATGGGCGGCGTCGCACTTGGCATATCTGCTGGCAGACAGCAGCAGTAGTAGCAGCACTAGC
AGCTAAAAAGCGGAAATGAGTAGCCGGAGGGACACATTTCTACCGGCAAGGCGGTTGCCAGATGAAAGGCCTACGGCTGGTGGCAGCGGGAGCGACAGTT
GCAGAAAAGGGGTCAACGATTACACGCGACAGCTGGCATGGCCGTCTGCGGGGGAATGTGTTCTCCAAGTGAAAAGATACGATTCGCTTCGCGTGGAACG
CTGGTCCGGATTCTGCAGCCACATGCGGCGAACGTTCTCACCGCCGTCTGGGGGTTTACGCAGTGCAGAACTCATGTTCTGCGACAGTGGAAATCCGTGC
AGAGGCAGCAGGTCGTGGTGTCGTCCGGCTGGATGGGTGCGGCCCGGCACTTGGTTCAACCACACGGCGCACCAAGCGGGAACATGTCAGATGCTTTGGG
GAGGTAATTGTGCACGACGGATCCAAAGTTGTGGTGGTGGAGCGGTGCGACTCAACAAAGCCGACTTGGACAAGGAGGTTGGACAGCGGCAGTTCCCTTG
CGAGACCGTCTTGGTAATTAAAACCGATTAGCGTCCGAGCCTTGATAGGCGGATAACGCCCAGTGCGGTCGTAGAGGGTTAGCGCGAATGGTAAAAGCTG
CCCGTCGGCACGACCTCTTCCGAAGTCGAGTCTTTTGCGAGGTATTAACCGGTAATAAAGTATTATGCATTGGCCTTATTCCTAGTGCAAAATACCATAT
TACCGATAAACCGTTAAGAGAGAAATATTCAATTTGCAAAAGAACGTTCTCGTTCGGGCCTCTGCCAATTGCTGCACGTGTTCCACTGTTCGGCGTCTCC
AGCTGGTTTCCCAGATCGTTCAATTCGTGTAGGCCACGCCAAAAACGGTATATGGCGTGGGCCACATTAGATACCGCTTCAACATGGCAGCAAAAGTGTC
CCTGCAGCTTTCCTTCTTCACGACGATGACAATTCCACAGAGCACCACCGATGTCGACGCCAAGACGAGGAAGGAGAGCTTGCTAGACTTTAGCAACCAG
TACTGGGGCGACAAGAAGTGCGTCGACGTTGTGGCGGCCGTCCGGCAGGCAGCGCCAGCCCCGATCCATCTCGACCTTCGAGGCAATCGGATCGGCGCGG
AAGGCGCCAAGGTGCTCGCAGACATGCTCATTTCGCCGCACTCGGTGGCATCTCTTTGTCTCGAGTGGAATAACGTGGGGTACCTGGACGTCGGCGTCGA
GGCGATCGCAACGGCGCTCGAGGCCGACACGAAGCTCGTGGCGCTGGATCTGCGCAACAACAACGTCGGCCCTGAAGGTGCCAAGGCGTTGGCGCGAGCG
CTGCGACGAAATCAAACACTCAGACGTCTCGATCTGCGCTGGAACGAGATCGGTGGTGCCGGAGTGCTCGCGTTTCGTGAGGCACTACAGACCAACGAGT
CGTTGCTGACGCTCGAACTCACGGGTAACAACTGCAGCCTCAAGCAAGTCGACGAGATCGACAAGTTACTGGCCAGGAACCAGGCTATTCAAGCCGAGAA
CCGCGTCGTTGCTCGTCAGGAGCCTGTGCCAGTCGAGGAGAATCCGGCAGGCAGCGAGGTTCACACCGACAAGCTCCTGCTGCATGTGCTGGCTGAGAAG
GAAGAGCTCGAGGCTGCGCTTGGCAGCAGCAAGAAGGAAGGCCACAAACTCGTAAGATCTGAGCGGATGGTGATTGACGTCTTGGTTTCGCCCTCACGAA
TTGTTGATTGCGCAGTCCGAGAAGGTGGACGAGCTCCAGTCCCAGCTCGTGCTTGCTCAAAAGGACGCCAGCATCGCCAAAGAAGACCGCGACAGGTGTC
AGCAGCGCGAGATTGACGCCAGGCGCGAGGCTCACGATCTCAAGCTGAAGCTGGACGAGCTTGAAAGCCGCCGCGCGCTCGAATACGACGAGTACCGCGC
GACCCGCGTCGCTCTCGAGAAAGAAAGCGTGCTGGCCTGCGAAAAGCTCCTCCACGCCGAGGCGCTGCATGCCAAGGGTCTCGAGCAAAAGAGCAAACAG
ACCGCCGAGCTCGAAGAGCAGATATACAAGCTGCAGAACGAGGTGCATCGTCTCAGCCTCGCACTCAGGTATGTGTTAGTCACGACATGTACTTGGTTGT
TGGACGGCTGGACTAATGCATAGAAGCAGTGCCAAG