Description :
From Genome Similarity Track
Location :
Scaffold_101:11945- 15983
Transcript NameFunction/comments
Physo_141590hypothetical protein
Physo_141591hypothetical protein

Sequence
4038 bases(100 bases per row)
TATATTGGCCAGATCCAAGACCTTCCTAGTAAACTACCTGCAAGTGCAGATCCAAGATCCATCGGAGTTACGGTGCGTCCCTCTCGTCTCAACTGTCAAC
GACACCGTCATTGGAGGCGGCAAACACGACCAAGGAAGACCTGCGAAGGCAACGTAAAGGACAACAACCTCGAAAGGCAACAACCCGGTCGGATCCAGAT
CCAGGCCGCCAGATCCAAGTACAAGACCACTGGATTTGGAATATTACCACGAGCAGAGTGGAGATTTCCGCGCTGCTCCACCCACATCCCCGCGTCTCGC
CCAGACTGTTCTCTCTTCAAGGCTCGGACGCTTCGGAAGACACCAGAGGAGCAAGATCCAGGTAGGGCTTACCGACGGGTACACAAGGTGACCAAGTTCA
GCACACAGATCACGGATCATCGGGGGACCCCCTCCGTAAGTCGGTGTTCGGGCGCAGTTGGGAAGTTGGATTGGCAATCTCGCAGATTTTGCTGATCCCG
CTACACCACAATGGTTGCGCGTGCCCGGATCTTCTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGAAGTTCGAGTGAAGAAGGAACAAGGGGATCA
AGCGTCATCGGAGTCGGGATCGACGACGACGCTGCTGAATGAACCAAGATCCACGGATCGACAGAGTGCAAGGAGGACCTCTGTCGGCGGAACCGAGGTG
GATCCAGACATGGATCCAGAAGAGAAACCTCAACCTCCTCCACAGGTCCCTTCGGGGACCCCGGTGGATCGCGACGCGAGTCAAGTTCCACCAACAAAAC
AAACCAAGGCTAGCAAGGATCGGTATGCATTTGCTGATTCACCAGTTAAACCGGATGCCTACTTCTTGACAAGACCAAGTCGATGACACGAGCGAAGCTG
AAGGCCCCGGATCTGGATGACGAAGATTCAAAAGCGTCATCCCACGAAGAATCCGAGGAGGCAGGCTGGATACGTTACCACGAGAAGCAGCTACGTGACT
TCCTGGCTTGGGATCCCATGATGCGGCTGCTTGGCGTGAAGCCGATCGGAGAAGGGCCTGTGGCATTCCCTGCACCCGCCAAGCGTGAAGGGATCCTGGC
CGAGATGGAGCGACTCATGCAGCGGCTGAAGGAGGCCGGCCTTGTAGCTGGCGCCTTCGACGCGAGAGCGATCTACGACGCCGATCCAATCCAGATCCAC
GCGACGACGGACATGCTGTTCAACAGGCTGAAGGCGCTGGTAGGTGAGATCCGGATCCAGAAGTCCCGGATCCAAGTTCACCTCAAGCTGGATCCACAGG
ATGCCGAACGTCGTCACCATACGTGTCCGCCGCGGAGCTTGGGTCGGATACATCTTCGGAGCCGCGGCGTATGTCGCTTGGACCCTCGGGAGCCTCGATG
CTACGCGCCCGAGCCCAGATCCAACGTGAAGCAAGGACTCAGCCCCGATCCCAGCCCCGACCCAAGAAGCCATCAACTGCTTCGGTGGATCCAACAGCTA
CGGCATCAGGATCGAACATATCGACCGGCAGACTTGTGTCATACTTTCAGGCAGCCATGGGCAGGTTCTTGAAGGAGCAAGGCGGGTTGACCCCGACACA
GGCGCCGGAGGCGACGCAGAACGCCGGATCCCAGGACGTGGAAATGGAGTCCACTGGTTTGTCCGATCCAGATCAACACTGGAAGTACGATCCAGATGAC
ATCGACTTCCCGGTCCCAGCTCGCGCTACAGTGGCCACCACCGCGACCGGATCCACAGGTTCGGCCCTGATCCAACGAGTCCGGATCTCAGCGGTCTCGG
ATCTGAAGGAGTTCTCAGGGAAGGACCAGGATGAGGATCGGGCGAGAGCATGGATCAGTAAGGTGAAGTCTGCGTTCCTCCGTGACCAAGCCCCTGACGA
GGAGAAGTGCTTGACCTTCGCGGACCTTCTGTCCGGATCCGCGAGGAACTGGTATCGCCAACTACCTCGATCCACACGCAACAAGTGGTCGGATCTGCTC
CGCAGTTTCCAAACCCAGTACTGTGGATTGGTGATCTCCGTTGCTCGCCAGTATTACCACGCGCGCAAGCGATCCGATGAGTCTCCGCTGGATTATCTCT
ACCGACTTAATGTCGCTGGACTCCGCGCCCGACTCAAGATCAAGGATGGTGGATCCAAGTAGAAACGCGAGCACGTGAATCAGGTCATCGAAACTCTGGG
TGATCAGGATCTAGCGGATCGACTGACATTGCTCCGACTGCCGGATGCTGACGAGCTGGAAGAGGTTCTCCGCGCACTGGATCGGGCGAAGAATCGACAG
AAGAAGTCTGCGAATGGAGCCAGCAAGTTCCGCCAGAAGGCCCCCGCGACACCCGCACCGGCCGCTCCGGCCAAACATGTGCGTGCGATCCAGGTCCAAC
CTGACACGGGATCCGAGCCTGGATCCAGCGATGAATCTGACTCCGAGTGCGACGATTACCGCAGGATCTATCTGGCGGCAGCCCAAGACCACGCGAAGCC
TGCAGAGGAAGAGCAGAAGACTCTGGATCGAAACCTTCAAGACCGTCCGAAGCAGGATCCACCGTCTCGCGACTCCCGATCCAGGACGCATGTGGGGGGA
CCCGAACGTAGTCGATGCACGCACTGTGGATCCAAGCGGCACTCGCATCTTGCCTGCTGGAAACGCTTGACGTGTGAGAAGTGCGGCAAGAAGGGTCATC
CAGGTGATCACTGCCTTTTCGTGTGCTGTGGATGTGGTGAACTTCATGACGTGGGCCGATGCCCGAAGGAAGAGTTCTACAACCAGATCCGCCAGTGGTT
CAATCCGGCCAAGCATGCGGGGATGCTGCCAGAGATGGCGGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTGGAATCCGGTACGAGCCAAACGTTCTA
GGTATTGCATCTATGCATTTGTGAACAAGACATCGACAGATCCAGTTAGCAAACGACAGGATCTACGCGGTAATACATGTGATCTTCATGGGAAACGTAC
TGCTGTGGTCTCAAGTCTCTGACAAGCTGATGACTACTCAAGATCCGACACGACAGTGGAAATGGATTATGATCCGGAGGCACGTCAGGGATACTGGAAG
CAGCAGGATCCAGACCAGTGGTTTAAGCCTACCGAAGGTGAAGACACGGCTGGATCCAGATCCAGGCGTGTTGCTGCGAACCGGCGGACCACGGATCCAG
AATCTTCGTATCTCCTACCCGGAGAATCCCGAGGATACTGGAAACAACATTCGCCAGGGAATTGGTTCCGTCAAGCCAAGATCCACGGTAAGATCAACAA
TGAGAAAGCGATCTTAGTCCTAGATACAGGTGCCGAGGTGTCCATCGTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCTACATCGGCAGGAGTCAGAGC
CAAGAGTGTGTTGGGATCGGAGACAACGTGTATACAACGGAAGGAAGAACACGGATCATGATTACCTTGGGCGGATACCTAATGTATTTCTTCGACATTT
ATCTGGACAAGAGGCCATCCTCGGTATGGATTACATGATGCCGGCCGGGATCCGGCTGGATCTGGCCGACGGGACTCTCTGCCTGCCCGATGAAGTCCGG
ATCCAGCTCAGCGGACGCCGTCCACTCTACAGTGACAAGGCGCAGTCCGTGAAGCTGGATCGATACTTGCAACTTGGGATCGGAGAGTCCGCGGAGCTGC
CCATGCGTCTGCGAGGATCGGAACACGACAAGCTGTGGGTTACGCGAGGGGATCGATGGGTGCCTACGGTAATCAAGGGCCCAGGCAAGGTACGGTACCT
TCAGATCACGAACATCGGAGAGAAGGAGCTGGTGTTGCGCCAGAGCCTCCAAGTCGGGATGTGGCTGGCCGGAGATCGAGTCCCGCGGATCCAAGGTTAC
GTGTCCATCGGATCCCGCCGCTACATGGAGTGGCAGAACCTCGCGCTGCAGGCCACGACGGACGCTGGATCCACGGAGGCGGAACCCCCGGAGGCCCCAC
CAGGGCCTATGGTGGAGCGCCCCGAATACCCGACGCCG