Description :
From Genome Similarity Track
Location :
Scaffold_1175:1194- 3242
Sequence
2048 bases(100 bases per row)
CTTCCTCCTAATCCACCCTTCTCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCCGACCCACACCCTT
CCTGTGGGTCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTT
ACGATTCGTACGATCCCGCAAGAAATTATTGAGTACTGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTAGGTTCGTCAAATCCACGCCAATACACC
AGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGAACTCGTCGGCCTCGAGATCCACATTTC
AACTATCTTCCGGTAGGAGGACTTCGTCGAAATCTACCCGGTCGGATCCATCCACCGAAAGACGGGTTTGCGGCCGATCCGGATATTCCTTGACCAACTT
CAGCTTGGATACGTGTACTACAGGGAACAAGCAATATTCGGTACATGCCGTCTCCAGCTTTACCGCAAGGTCCCTTATCTTTTCGCTCACCCGGAACGGT
CCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGT
CTTCGTTGTGTCGATCCGCTCGATTCTGTATCGCACTCCGCAGTCGTTCGTTCACCGGGGATCTAGCTTGCTGGTAGTATTTCTGGACTTGGTATCGCCA
TCGCCTTGGATCTCGGTCTCTCTTCTTGGTGCTGCATACTGGGATGGCTGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGGT
ATCACCCCGGATCCTGTCTTGGGGCGGTGTTTATCGCGAAAGGGAGTCGTTCCTGCGTACTCATCCCAATCCCTTTGATCCAAATCCTGAACATACATCT
TGAGTGCTCTCGTGATCGTCTGCACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGATT
AAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCTCCAAATCTTCGGAAAACACACTCCTCGTACGATTCA
GCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACT
TGGGCAACGAGGGAATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACCCCCCTTCGATTGTGGGCCTACCCTTGCC
TGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGCCCCCACCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATA
CCCTGATATCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGT
TGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCGCCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCCGACTCAG
GTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAAT
GTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGTACTGTCCTTTTCCCGGATCCCACTACCATCACTT
CGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGC
ACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCA