Description :
From Genome Similarity Track
Location :
Scaffold_467:1194- 3214
Sequence
2020 bases(100 bases per row)
CCTTTCGGTCTCAAGAACGCACCCCAGATTTACCAACGTCTGGTGGACAACGCATTGTATGGCTTCCGTCGAATTCCAACGGTCGCTGGCGAAGATGTCT
TTGAAGAGGGCGAGACCGGAGACGCTTTCGCACCACCCGTTCTGGGACGAAGATCGTACATCGATGACATCTTGATCGGTGGGACGTCTTGGGATGATTT
ATGTGAGAAGGTGGAACGTTTGCTGGACGCATGCGAACGTTGGAATCTGTCTATCAGTGTCGAGAAGAGCTACTGGGGTATGGACAAGGTCGACTATCTT
GGTCACTCGGTTTCTAACCGCAGCCTGGCAACACAGTCCAAGAACGTGGAAGCACTGACGACTCTCGATTTACCGCGGACGTTGAAAGGGCTCCAGTCGT
TTCTGGGAAGTTCGAACTACTACCACCGTTTCATGGGTAACTTTGCGGTCTACGATGCAGCTCTCTATTCGCTGACGGAAGAAGATTTCGTGGCGCGACG
GAAGTGTTTAGATGAGAAGCTTACCGAATCGGACGAAAAGTGGTACCATGCGCTGGCTGCGTTTGGAGTGCTCAAGGAGAAGGTGGCGCATACACCCATC
CCACGCCATTACGATCCGGAGCGGGAACCCGTTGTCATCTTGAACGCGAACGATTGGCCCGTGGCCGCAGCCCTGGCTCAAGCGCATGATGGCGTTTAAC
TACTGGTCAAGTTCGGCAGGCGTAGGTTGAAGCCAAATGAATTGAACTACGATCCAGTGGAAAAGGAGATCTTGTCCCTGCTTCAAGTTCTCGACGAGTG
CTTTATGATGTTGGCCGGGCAAGAGATCCGGGTGCTGTCCCGCAGGACCACGATGGCATGGGTATTCCGTTCCAACAACCTGCAAGGTCGCCGTGGAGTT
TGAAGATTGAGCGATCCGATCGCGGAGAAGCTGAGATACTGGGAGCAATTGCTGCCAGCATCACCCCGCGAGAACATGTCGACGCCGCGCTGAAAGAAAT
TGCCCCGCGACGGAAACCAAGATCATCGTGATTCCATCGCCGCAGGTCGAGGACGGGGAAGAACTTCATGTATTAAGTTTCGATGGCTCTGCGAAATCGA
AGCGTGAAGGAGGTGCCTTCGGCACCATCGTGTGGAAACTGCCCCAGTGGGAAGTGGCCACGGCTGCTTGGGGGTACGATGTGGACTTGACCGTGAACGA
ATCCGAGTACCGAGGCCTATTGTTGGGTTGCGATCTGCTTCGCGGCATGGTCGTGAATCGCCTTGTCATCTGCGGAGATTCGAACTTGGTGATACGGTAG
ATACGTGAAGAGATGGATTGTAAGTCTCCCGGTTTGGAGCTTCTCCGCGGCCGAGCCTGGAGTGAGCTGCAAGAGTGGCCTCGACGCGAGTACTTTCACG
TTCGGCGGGATTGGAACGCGCGTGCCGATATGCTAGCAGGACAAGCTCTACAGCGGCATTGTGGTGTGATGGTGGAGTCCCAAGAGGACAAAGCTGACAT
GCGGACGCTCAATCGCCTCCCTGAGATCGTTGGGGTGAGGACTTCCCCGGTCGTGACCGGATCGGGGACAGATGCAGAACGTACCCCAAGTGCGGGGCGC
CCGCAAGTGACACCAGTGATAACCCGGGCCTCCGCGGCGCGTTCCGCAGAGAAATCCGCTACGACTCCAGCGGTGCTAGACGAGGACATCGTCCAACGGC
TGCGGCTGGAACGTATACGTACGGCGCAGGACGAGGAACGGTGGATAGTGGACTTGAAGAAATTCTTGCGAGGTGAAGTTGACACGCTCTCGAGGAAAGA
AGCAAAGTGTTGCAGCAAGCTGGCCTACCAATACGAAGAAGACAAGGACGGGTTGCTCTACTATCATTCGCGGGGCGACGAGGATGTCTCGGACCGTAGT
ACGATTCTCAAACTGGTGATTCCGGATACTCTGCAGGATGACGTTCTGCATCAATTCCACAGCAGTCTTGAAGGGGCAGATCAAGGGATCGGACGGACAT
ACTAACGAGTACGCAGGCAT