Description :
From Genome Similarity Track
Location :
scaffold_204:11937- 16510
Transcript NameFunction/comments
Pl_107748hypothetical protein PHYSODRAFT_474714

Sequence
4573 bases(100 bases per row)
TGCTGTGGCCAAAGAGAAACCGAGCAACGGCTTAAGCACCACTCCAAAAGCACCAGCCATTAACCCAGGCAACACACCACGCGCACCATTTACTTCAAAC
GAATGGATCGGAGCTACCACGACTCCAGAGACACCTTGCACAAGACCTTGAAAGATATGGCGTGTGGCTGGGTAGCCTGTGTAGTCATCCAGCTTCAGAC
AAGCCTCTGATAAACCTAGTGAAAAAGCCGTGAGGATGCGAGTATTAAAGTCCAGGAACGTGTACACGGATGCACGCACGAGCGACAGTGATCCACGGCC
CACACCGAAAGCAAACGCCTGTGGACTTCGCTGCAGAAGCCCGTGTGCTGGCTCGGAGATAAAGTCCTGGAACCCACTGCGTAGATTCTTCCATGCAATC
ATGGGGTTGCCTAGTACGTCAACACTTCCGAGTATGACATAGGCCTGGCGAAGCGCTTCACTCTGATAGTGCGACGCTAATCGCGTAGCCAACGCATCTG
GTTGTACAAACGAGTTGTGGATGTGCAACGCCTTGAGCTGGAACGGAGCATTCGCAATCTTGGTCAAACTGGTACCGATAGCGTTTAAGATAAGTCGTAG
GGGGCCAACCGTAATAACAGATGACTCTCGCGACGACGATGAATCCGTTAACGCTGCTGCGTGCGATAGGGAAGACAAGTGGCCATCCACAATGGCACCT
GCACTATCGCCAAACGAGAAGCTGACAGTAGCGCGGATGGGGTCGATGTGAAACTCTTCAAAGTAGAGCTTCTTCATTTCGTCCTTTGCAGCAATGGCAC
CGAGGCTCCCGTACTTAGCTGCTGTATAGCGCTGAATTTCCGCAGCCAGTGCGGTATGCTGATTTTGGCGTGGACTTGCGAGCTGATGCTGACCGCTGTT
TCTACGAATGACAGATTTCATCGTAGGTGCTGGCGGGCCAGAAGCTGGTCCCGCCGATGTATTCCCGTCTTTCTGAGCTGCCTCAAGCACCTTCACCGGA
ACCTCCAGACTGGCATTAAAATCATTCAGGAGTAAATGGCTATGCGCAGCTCGAGTTGCCTCATCGCTGCTACTCACACCATTCACCAGCACAACCGTTC
GCTTCATGGTTGCCGCACTAGAATTGCCGCTGCTACCATAGATTTTGGCGTGCACCAAAAGTGGAAGTATCTGATAGAGTAGAGCACCGTCCACACGAAT
GTGCACCGGTAATACGGTGACGCTGAAATGCTTGATAAATTCGATACCGGCATACTCGTCATGTTTCACAAGGCCCACCTGCAGGACAGGAATATTTACA
GTTTGTCCATTCACAATTCGAGATCTGCCGTTTGGATTCGAGAAGCGAAGCAGCACTGGATATGGTGTCATCTGCAACTGATTGTCAACTTGCACATCAT
TCACCTCGAGACAGCAAGCAAGAATCCGTGGTTGGGTCTCGCGTTCGAGACGTGACAGTGATGCTGCGCTTCCCGCAATTGATGCCCCGCTATTGTTTCG
GTCATCTTCAGAGACGAGAACCTCAAAGGCGATACCAGAGATCGACATATACAGCAGTTCCTTGGGGGTACTGTCAACGATTGAAATACCCACACCCTGT
AGATGTAACGTTACATGCGCTGTGGGGGCATTCACAAAGCGCTGAAGTAGCTGCAATGCACTACCGTCGCTTGCCTCGGTCTTCGCTGACTGGTCATTAA
GTGCCTGACTGCTGGGAACAGCCTTCTCGCCACGTAATCGGGTATCGGTGAAGCGCAACACTCGAGTCGGTCCATCCGTGGAGATCTCAATGCCCAGTGT
GCCACCGAGTGCATCGGGGTACCTCTGAATTTTATCCAAGTCGAAACTTCCGATGCGCAGAGGACGGCTGTTATCACCAGCGGCCGACGGAAGCATGTCG
ACAACGAGTAAACGTTCCTCTGTGGGTTCATCCCATGCATAATCCAGACTGTGATGTGGCAGTAGTATCTCACTGCGGCGAACACGATGCTGGTGGGTTC
GCAGTGTTTCTAACGAGTAGTTTTCCACGCGATATGGTGGCACAGTCGTGCGTTCTTCACGGAAATATACGCATATACACGAGGAGTCCAGCTTCAGTGA
AACCCGCACGAGTTTACTCTCTCGTGTAGACTCGTGACGCATGCGAACGGCATACTCACCAGACTCTACCAATGGCACACCACCACTCCACGACCAGCCA
TATTCTGCGAAACGGCATCGAATAGTGCGTGTTTTAGCAAATCGAAGTGTCCAGTGGAAATCAGCAAATGCTCCCGCATCAAGCTGAACCACAGGGTTTA
CAGGAGACATTACGCGAGAGTTTGGCATCGACCCACTAGCGTTAGCGATGTCAATCACAGATGGAGTCATCATCTTGGACGACGAATGGCACACTTCGAT
GGCACTACTCATTGTGTTGATGAGCATGAATCGAGGTGTTAACATGATCACTTTCGTCCGTGAATACTGACCTTTTGCTGGAATAATTGAGTAGCCGATG
CTAAATTTTCGGTTTGTCCCGTAATCGTCAGCTTCAATCTCTCCAATCGTACCAGCTTGATCTAAAACTAAGGGATCGGACCACTTCCGCTGTCCACTCT
CCTTTCTTGCATCAAGAGCTGCAACATCTCTTTCGTTGCTGACGCGAAGACGAACACATCCACGATCTGTCCTATAGTCGGAATGACAAGCTTGTAGAAC
TTCCAGTTGTCCAAGGCTACGAGGGTCATACTCGATCGTTTTTGGGAGTAGGTCCAGCAAACCCTTTACTGCTGGAACACTCGGAAGAAGACGAGGGTGA
TGTCTCTTGCGCTCATTATCTCGACGATTCGGAGAAACACTGCGACCAGATGTGGTGCTTAAATCCTCTATCCCATCCGCAAACTCGTTGTCTTCAAGTG
GAACAGGATGCAGAAGATGAGGATTGCGATCTCGCCGGACTGTCCTTGCTCTTTGGGTTTCTTTCAGTAGGAGCTCGTCACGATCCAACCTTTTTTGTCC
TGCGAGCAATCTAGTAGCATGAACAATGAGCAAACACATTTAAGTTACTGATACCAAAACCATTTCCAATATCACCACAGTGGACACAATACGTACGTGG
TGGAGTGTTCACGCCCCATTCGTTCTTCGTCATATTCGTACTCAAGTTTCAGGCCCGTCAGGTTAACAATCCAGTATGGTACATAAAGGAACAGTTCGCG
GCAGTGACCCTTACTCATCCGAATATCTGCGGTAATATAAAGCTGTGCATCGCTCACGAGGTCTTTCATCTTTATCCGTACAACGTCGCCCAAGTCTTCC
TCAAGCTTAGTCGACTCGCTCCAGTCAAATCCCTTCATTCTGACACTCAATTCGAGAGGTGTTTCCTCACTCGACAAATGCCAAATCAATGAGTCGGCAA
CATTGATAGTTCCTCGTTCGCGCAAACGTTGCTCACGAGTTTCCCACCCGGCATTCACCCCCGCGTTTGAAAGTGTCACAGTTTCTACGGCAGGCGACCA
ATCACTCGGAGTTGCCAAGCAAAAGTCAAGTGGTCCTGCGGTTAGATTGTGTACAATAAGCGGTGGATGGAATGACAGTGTGCGGTGATACAGTGCACTA
CTCGTGCTCGAGAGACAAACGTTCATCATGAATGGACGAACAGGTCGGTCACTATACAATCGTCGGAACTTGATGGTACACTGGGCCTGGCCAAACTCAT
CTGTTTCCATGTGCGTCATGTTCTCGTTCGCCAAAGAGCTACCTCGGTCAAAGAGCGGGAGATGTACCCGTTCTTTAGCGTAGGCTTTTGGTAGCAAATT
GCCGTCTCTACTATCGGCCCCACTAATCTCTGGAGGACGCACCATTACATAGCCTTCGCCGGAGGATACAATATGCACTGGGACGGGGACAACAGACGAA
GCATTAACAATTTTTTTCCAAATCGGGATAATGTGACCTTGTGAAGCAGTTCCCGCTCTCAATGATCGTGACACCGAACGTCGTTGGGGAGGCACAAACT
CGATTTCTAGGTCAGATGACGTTTGATTCTCAAGAATCAATGTCGATCGAACCACAAAATATTTGCATCCACGCTCTACTAGCACGTCAATCACACACTC
GCACTTCCTCATTCGAGTAGCCGTAATATCCGCTTCAAAATCTACCAAGGCATACATTCGCGAATCAACTTGATCAACTGGAATGGGTGCTTCACTTTGC
CATTTCCTTGGAATATTTGACAGGTTGTCACTTGGGTACTCCTCTTCTACGGCAATAAAGATATGACGATCGTGTACGTGGGCATTACGTCGACTTTCCT
TTTGACGCTTTCTGCTGTCGTCCCTGTTGTCGCTATCCGACTGATCTTTATTGAAGCGAAGAGGTTCTTCTTGTCCAGGAGCGAGAGAATGCTCGTTGTA
CGACGCACCCCAGTATCGTAGAGGCATGCCGGTGTTATTTCGGATCCAGTACGTGGAATACTCTGTCATTTCGCGAGAATCGCCACCAGCGTTAACAACC
CACCGCCAAGCTCGATCTGCAGCAACCAGGTTTGCAATCAGTGCATCTGTTAAATTTAGTTGGAAAAAGACGT