Description :
From Genome Similarity Track
Location :
contig_95:11930- 16881
Transcript NameFunction/comments
g10876.t1hypothetical protein

Sequence
4951 bases(100 bases per row)
GCAGGTTGCTCTGGATCAGCTTGCTCGTCCCACCGTTCCCCGCGCTATCTGGATCCCTGGATGTTGTGCTCGTTCTCGTAGGGCGGCAGCGGACGTTCGC
CCGTGGTCGGCGAGCACTCTGAGCCGGGTCAGTGTCTTGGAGATGGACATCGAGTTGCTCTTTCATCACCTGGCAAAGCTAAAAACTGGCTTTTTCCGCC
GCAGAGTCGATCGCCTCGTCGCGGCGCTTGGTCACATGGTCTGATCACCGAAAGCAACATTGCGGCACTTTACGCGACGACGCCGTGGAATTCTCTCAAC
GTCTTGGTGACGCCTTTATCTTTTGAGGTGACTGGTTGGTTCGAGGCGATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGGG
AGGCTACGCACGCGTTCATGATCAGCTCCGCGCTTCGTAAATCGAACGCATATCTGGCGCGTCTTTGGGAAGATCGTAAGCAGAGACGATCCGCTTCGGT
GCCGTCTGGAAACGCTTCCTCAAGTTCATCTTGCAAGGGATGATTGCAGGGCACTGCGACTTGGATATTCTGCTGGACCCTTTCTTTCTGCATTATCCCC
GGGCGCACGAACAACGGTTTGGTACCCTGGACTTGGCTGCAGCTCTCCGCCCCAACCTGGTGGACGTCCTACGTGCCGTCGATCTGGTTGACCCGTGGCG
CAATCAGTATCGCGGCCACCTTCAAGATCATCCGGTCTCCCAACTGCCCCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAATGAGGTAGTTAGTAG
ATCGTATATCTTCTCAATATGATCCTCACGGCTTCTCCCTTTGTTGTTCTGCTTCATCATTTTCTTGCTTATCGAGCATCCCGCTCCGATCGAGAACAGT
CGTCCTCGATCTACACAACAATATCACATAAAACCCTTCCACCTCAATGTGCGACCACCTCGCACACTATTCACACCACTCCTCCGCTCACAACAGCCAA
CCTGCTACGAGCTCTCCTCCCCTGCCTCGTCATAGCGAAGCGATTCCGGTTGGTGACTCCTCGCTCGTACTCGCGCAACAAGGCTCCGCAATTCAGATCG
GCTTCATCAACCCACGAAAGCTGATCGTAACCCTTCCAGCGCACCTGAAATTCTCGATGGACGCGACCATACCGCGTACGTCGACCTGATCGCATATTCA
CGATCTTCTCCACCTCGAACTCGTCCTCATCTAAACCGCCTTCCCAGCTGTCTTCGGGTAAAAGTGCCTCATCAAAGTCGAAGCGATCGTCTTCGTCCAC
CACCAGCGTCAGCGTGGGGCGATCGGGAACGATCGCACAGGCTTGAGTTTTGACACATGGACGATCGGGAATAACCGATAGTTGGTGCCAGCGACTTCCA
ACCTTGCTGCATGATTGTCAAGCATCTCGATCACCCTGAACGGTCCGTGCCACATGTGGGCTAACTTGCGTGCATAGACCTCCTTCACGCGATCTAGGTG
CAGCCACACTTGCATATTGGCCTCAATCCCATGAGGTCGGACCTGATCGTTATGCCCGTCTGCTCGTCCTTGGATGGCCTCCCGCAGGGACTCATTAACC
TCTTCTCTGGCTCGACGATAGTGGCTCTGTATATGATATCTCCACCGACGAGGGTCACGATCCCACCGGCGCGTGCTTCCGAGAGGTAGCGACGCTTCTA
ACGTAGATTGCGGGTCCCACCCGTGTGTCAAGTAGAACGGCGTATCTCCTCGAACCCGATCTTGGGCCGTGTTGAGCGCGAACGTCAGTCACTCCGCGTA
CTCATCCCAGTCCTGTTGGTTGACGTCTGCGACATACCTCTTCAGCGCACGTGTCAATGTTTGCACCATCCGTTCTGCCGTCCCATTGGCCTGTGGACGA
TAAGCCATAGTGGCCCTCTGTTTCTGTCCCACTATCCTGCTAAAAGCACGGAAAAAATCAGACATGAACCCAGGTTCCCTGTCGTGCCGGATAGCCTCAC
TGGCTCCAAAACGCCGGAAGACGCATTCCTCGTAGTTCTCCGCAATCGTCTGCGCTGTTCTTGACGTGCTCGCTTTAGCGATCACATAACCCGAGAACAG
GTCTACCCAGATCAACAGCTCCGTATTGCCTTCGAAGGACTTGGGCAACGACGGAATGTGATCCATAGCGATGATCTGAAACGGGTACGTCGCTTGCACG
TTCCCAGGGGATTCTCCTCTCACGAAGGGTCGGCCTTTCCCTGTCTCACAATCTGTACATTCTCCCACATAGCGCTGAACTCTTCGGTATAAGCCCCTCT
AGTGGAAGTGTGATCGGATTCGTCGGTACGTCCTTCCGATTCCTTGATGTCCCCTTCCAGACTTGCGTGGTAATGATGTAGAAGATCTTGTTGCAGGGTC
TCAGGCACCACCAGCTTCGCGATCACGTCTCGGTCCTCATCCTGCCGCATGGCTGACGGGCAATAGAACAGCAGGTCGTTTTCGTCCAACTCGTTGTCGT
TTGCGACCTTGGCGCACGATTTAGCTTCGGCTGCGGTTAGAGCCTCGACGTTCCCTTTCAGGTACGCTTTCAGATCGATGATCCACTTCTTTTCGTTCTT
GTGCTTGGATGATTCGCTCACCGCGTATGCGCTGTACAATGCTTCTTGCAGGACTTCAGGAGTCAGTCGTCAGCGTCGCGTTGACCTGGTCACAGCAGAC
ACACGGACGACGGCATCGTCGTCCCTCGTCTTGAGGAGATCGTCCAAACGGTTGAGCGTGATCAAGTCTTGTTGATCCTCGTTTGAGGTGACTACGACCC
CTTCGCCCCGTTGGAGAGCTTCACTGGCTAGCTTGTCTGCACTCTGGTTCCAATCTCGTTTCATGTGTAGGAACTCGTGTTTTGACCACGATCTAAGTTG
ATCCATCGCCTTCTGACTCAACAACAACAGACCAGAAGCTTTGCACGCGATCTCACCACGCATCTGGCGGATTACCAGATTAGAGTCGCCGCAGATCACA
ATCCGCCCCCTGTCCATGGTGGACAGCAGATCGAAGCATAACAACAACCCGCGGTACTCAGCCTCGTTCACAGTCAGATCGGGCATATATTCTGATGCGG
CGGTTACGATCGTCCACTCTGGCAACTTCCATATGATCGCACTGTAAGCTCCACCACTGCGTTTGACACGTGCCGATCCATCGAAACTTGCGATCAACAA
AGTTTCGTCCGCTTCGAACGTAGTTGGTGGCATGGTAATCGTCTGTCGGGGCTGCTTCACGGGTGCAATCCGATCAACGCCTCGTCTACTTCCGCTTGAG
GTGTGATGCTTGCTGCCATCGTGCCTAAGATTTCGTCTTCCCCTTTCGTGCACTTCCTGATCTCCAGTGTCCACTCTGATAGCAAGGCTGCCCAATTGCC
AAGTCTCCCCTGGAGACTGGCTGAATTGACTAACCAAGCCAGCGTCGAATGCCTGGACAGCACCAAGATCGATCCGTCGTCAGCAAGGTGTAATTCACGT
CCAGCATCCGCAAGAGTGCCAAGACTTCTTTGTCGACAATCCCGTAGTTGATCTCGTTAGGTTTCAGAGTACGACTGGTGAAGGTTACGGCCAGTACACG
CCATCATGTTCATGCACAAGAGCTGCGGAGATCGCCCACTGACTCGCGTAAACTACGATCACCGGAGTGCGATCTGCGTCGAAATGCTTCAGGATCGGGG
TGGACACGATCTTGGCTTTCAGCATCGTGAACGCGATCTTCGCTCGGGCCCAGCGGTCAGCGTCTTCCGCTCGCGGGACATCGCCCCCAGCTACTTGTTC
GCTGGGAATGGATCTGTCCTGTGCAATCTCGTGGAAATCCGCTTCGCGCAGCTCGTATAATACAGCGGCATAGATCGCGAAGTCTTCGATGAAACGACTG
TAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGGTTTTTCGGATGGGCTTCCAAACC
GTCGGCGGATACCTGATGTCCCAGGTAGTATACCTTTCGTCGGCCCCAGAAACTCTTGACCACGCTGATAGACAAATTCCATCGCTCGCATGCGTCGAGC
AGCGCCTCTACCTTTTCGCACAGCAAGTCCCAAGTGATCGCGGTCACCAGAATATCATCGATGTACGATCGCCTTCTCAACACTGACGGTTTCGGCTCTA
GTTCCGGCTCGCCTGACTCGAACACGTCGATCGGTTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTATCGATCAACCACTG
GTAGATCTGTGGCGCATTCTTCAGCCCGAAAGGCATACGCGTCCACTCGAACAATCCGAGTGGCGTGATAAAAGCGGAGATCTTCCGTGCGCGCTCCGTC
ATGGAGACTACCCAGAAGCCACTCGTCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAATTCTTCCAAGAGATCGCTAATCAGCGGCATGGGATACA
CCATCAGTCTCGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGCCCACGGT
GAAGTCGACGGCGTGATCGTCTTTGCCGATAACAGACTCTTGATCAGATCTGACAACTTCTCGCGGAACTGTGGAGCGACTTTTCGGACGCGTTGTGGAA
CGGGCCCTCTCCCACATCGATGTCGCAGACTGCGCCGACGACTGCCGGTGGTAGCGTGTTCCCTTTCCCGATCAGGAGATGTTTCCGTCTCCAAATTATC
TGTCGCAGCTGATCGATTTCTTCCGGAGTGTTCGACTCTGGATCGCCCACCTGGATATCCTGGATCGTGACCTCATCGGTGGCGGTCACTACCTCTGGCA
GAATTGCCATCTGTCGTTCTACATCTTCGGCGAAGAGATCGCCACCTTCGT