Description :
From Genome Similarity Track
Location :
Scaffold_27:1193- 2628
Transcript NameFunction/comments
Phyta_totarag1439hypothetical protein

Sequence
1435 bases(100 bases per row)
TCAAATTACATTGAGCACCGCAGTTAGCTCCAGGTTGCCGCCTTGTGTGGATCGAGGGATCCACAAAAGCAGTGAGCCCCCTCCAGTGCCGGGGAGACCC
AGAAATCCTGGACGCCACCGATCCAAATACAGCGATTTCCCTCCCAGTGCCGTCACATTCGACATCCAATTCTCTGTCTTTCCAGCCGCGACAAACACTT
CGTCGATCTTGTCTCCACCAGACTTGATGTTGACGGTCACATCCTCCGTGTCAACACTCTTGAATGTGACGGAAATTGTTCCATCACTAGCTCTAGACCA
CATGCCGCCACTGTTGTTGAAAGCACCCTGGACAATCGACATTTCCAACGCTTTTTGAGCAGTACCGTCGTCTACCTCCCCGATAAGCTCTGTGGGTCCG
CAAATGGGCTGAAAGTACTCGGAGACAAGACCAGTGATTGCCCACATATCCCAGATTGCATATAATCCTAGGGCTTTGTCGGCAATCCTGAACGTGTACT
CTCCAGCAGTGAGATACGTCCCGTTACTACTTGTTCCAGCGCTAATcaggtcgtccacgatgcCTCCAAAGGTTTTGCGTAAGGTATCCCGCGTAGCGTA
GGCTGTAGCTTCGTCCGATGCGGCGATTAATTCATTCATACAGTTGTTTGTCGCGACTGGGATGTCGTTTAGCACCAGGTTCGACTGACTCATGGCAACT
CGAATGATATTCTCGGGTTTTGTTTACGAAATTCTGCCAAAGTCATCCACGTGCGATCCAATAGACGCTTCATGTCATACCCGCAGGAAACGTTTGACTC
CATCGTCGACTTCAAAGACGTGATATCAGTCTTGTTCAGTGAGCTGATTGTCTCTCCCAGCATGATGTTCTCCATGAAGTTCGTGAATTTGTCCCAACTA
GACACAATGTAATCGTCGTTCTTAATGATTTCCCCAAAAGCAACTCGGCAGTGGTAAGAACTCTGTCGGCGAGCTTGACATCGGTATGTCGATAACGACG
TTGTCCGTTTGATGCAATATTGCGAGGATCTCGTCTTGCGAGGTCTCAGGATTGGACACCTTGATATACCGGGTATACTTGACCAGTGACTTAGTTAAAC
CGAGCATGCTCTTGAAACACTTCACAGCCCTCTGCATTCCTTTCGCCAGTTTGTAGAAATTGCCAAACACACCCATCGTGGCGAAGGATAGTGTTATCTG
GACCACTGTACCAACTTTAGTTGCGATTTCCAGTGCACAATCGTCGTTTTGTCGAATACACTCCAATCCGCACTCGACGGGGTACGAATAAGGACACTGC
GCCCAGCACATTCCGAGTTTGCTGTCGAATCCTAAGGGGCATGTCTTCGCAATGTGAGCTTCGCGGTAGCACGCTGAGGCAATCGAGGTATCGAGTGCGG
AACCGACCCAGTTGACGTAGGTAGCCTCGATCGTG