Description :
From Genome Similarity Track
Location :
Scaffold_129:11929- 13586
Transcript NameFunction/comments
Phypl_g3779hypothetical protein

Sequence
1657 bases(100 bases per row)
AGTACCACCACCAACACCGATAACGCAATTTCCCACGTCAACATTTCTTCTAGCATCCCCTTTATTCTCTCCTCTGGTGTCTCCACTGGAGAGGAATTCG
TCTCCACCTCACTTGCTTCCGATGCGTTTGCCAATCTGTCTCCAAACGGTCGTAGTAGCTCTTCATCCCCACTACTTTCATCCAGAATGCTCCTCGCTGG
TACACAATCGCTCGAGTCAAGCCTCCTACCTCGTGGGCCGTCACTGGTGAAGTAGTCGACGATAATCTGCTTGGACAGCGaggcatcagcagcagccagt
agAACTGTCGTACCGAGAGCTTGGTCCGTCGCGTCGGTCCCGTTTTCGAGCGTTGGCGTCGTCTCGAAGCTACTCGAGTCCAtttcttgttcttcttgat
cagCACCAGGTCTTGGTGTCGTGAACTTCTCGTCTCCTGCCGGTCCAAAGCCGTCAGCGACAGTGTCCAACCGTCGCGCCCTGTTGACAGgtttgagctg
cttcaagaTACTTTTCCCACCTTGAAGTGGCCTGTTCGTCGACAGTACAGCAGTGTAAGTTACggaccaagcagcagctcgcgtccCGTTTTCGTGACTG
GTGATGGAGGCTTCAAGCATtaacgcagcagcgcaacgcACGCTCCGCTTCGTGTGCGGGTGTCGTGCCGATGGAATCGTACCAGAAGCGTATTGTCGGG
ACGTGGAGACGGCTGCAGAGCCGCCGTcgaagcggcagcgcgtGGGTGAGTCTTCGATTGTCGAGGTGCGTCTTGTCGAGCTAATTCGCGacctggacga
ggccaacgaTGACAACGACAAGCATTACGGCCTGTTTGTATGGCCGTCGGCGCTGTTATTGTCTCGCTTCGTTGCCCGGGAAGCAAATTGGCTCTGCCGC
GATAAAGTCGTGCTGGAAGTGGGCTGTGGCACAGGACTCCCGTCGATTCTCGCTGGCTTGTGCGGGGCTGCGAAGGTCTATCTCACGGATCgagccgacg
ctgccgacaTCCAGCGCAACGCAGAAGCGAACATCAAACGGAATGGACTTGAAACTCGTGCTGCGTTTATCCCCTTGGCCTGGGGCGACATGCTCAtctc
ggacgagctcatttcCATCTTCCAAAGTGTCCAAGTCATCCTCGCTGCCGACTGCTTCTACCAATCTCAAGGTGCGACGAACCACTTCAAATTGCTGCTC
AAATTCTGTCAACTTAGCGTGCATTCTTACAGATTTCGAGAAGGTGATCCCTACTGTGGCGCTCATCTTCCGCTGCAGTGGTGGTCCAGCCTCGTGcaag
ttcttcttcacctACCAACTGCGCAGTATCAGCCGGTCAATCGCCCCCCTCCTCTCTCGCTGGGGTCTGACTGCCAAGGCAATCGACAAAAGCGAGCTCG
TCAGCGACTCAAACGATATGGACGACAGCTCCGCCCGGGACTTTGACAGCGTCTACCTCTACGAAGTCCAACGTCAACACTAACATGAACTATGATGCAA
ATGGGTGGCTCAGATTCGCCTTTTATCTTCTGTCTCTCACCGTTCCCTATAGTGTTTTCCAGTGTTTTCCAGTAACTTGGAAAATGTCCCTCCCCTGATC
TAGAGCACATGTGCGTGGGGCtctcgcagcagcctcttcaGCCTTTCAACGGGAGAT