Description :
From Genome Similarity Track
Location :
Scaffold_872:11926- 13164
Transcript NameFunction/comments
g18015.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
1238 bases(100 bases per row)
GGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCG
GAGTTACCGCAGGACAAAGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCA
AGGCAATCGATGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACA
GGGCGGGTGGCGCATCGTTCATGCTTACAACAAGCTGAACGATGCGACGGTACCGGCACCGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATG
ACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGCGAGAGTGATATTCCTCTCACGGCGGTAAGCACTCCGA
GCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGA
CTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATTGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTT
GAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGGAAAACGGCG
TACGCCCTGACCCAGGAAAGGTCAGAGTGATCAAGGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTG
CAAGTACGTGAGAAACTACGCGGGCAAGATTCGCCCGCTGTTGCAGCTCTTGAAGAAAGATGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTT
GAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCG
GATGCGCGCTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGA
CAAGGAACTGCTTGCCATGAAGTATGCACTCGCAAAGT