Description :
From Genome Similarity Track
Location :
Scaffold_22:119222- 120575
Sequence
1353 bases(100 bases per row)
AAGAACGAGACGTGGACCCTGGTGCCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTCCGCGTGAAGGAGAACCAGTCTGGAGAGATCG
AGCGGTTCAAGGCGCGACTGGTGGCGAAGGGGTTCTCGCAGAAGTACGGCATCGACTACGACGAGACGTTCGCGCCGGTGGCCAAGTTCACGTCGATTCG
GGTGTTGCTGAGTCTGGCGGCCAAGTACAAGCTCACAGTGCACCAGATGGATGTGAAGACCGCGTTCCTCAACGGCTTGTTGGACGAGGACATCTACATG
GCGCAGCCGGACGGATATGTGGACGGAGATCGACCCGACTACGTGTGCCGGCTCAAGCGTTCGCTGTACGGCCTGAAGCAGTCGCCGCGGATGTGGAACA
AGACGATCGACGAGTTCATGTTGAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCATCTACTTGAAGCGGGACAATCACGACATGATGTTCGTGGC
ACTGTACGTGGACGATCTGGTCCTCGCCAGCAGCAGCGACAGGATGCTGAAGGACACGAAGCAGGCGCTGAGTGACCGGTTCGAGATGACTGACATGGGC
CAGCTCAAGTACTTTCTCGGTATGGAGATCGAGCAAGATGTGGCGACTGGGAAGGTGTCGGTGCGGCAGACCAAGTTCGCGAAGGACATTCTCGAGAAGT
TCAAGATGGATGAGAGCAACCCTGTGAAGACACCGCAGGATCCGGGTCTGAAGCTGACCAAGGCCATGTGCGAGGGAGGCTGCAAGCACGACGAGACCAT
GGCGAATGTTCCGTACCGGAACGCCGTGGGCTGCCTCATGTATCTCATGGTGGGGACTCGTCCGGACCTCGCAGCGGCAGTGGGAGTGCTGAGCCAGTTC
GCAGCGGACCCATGTCCGACACACTGGCAGGCGCTCAAGAGGGTCTTCCGCTACATCCGAGGCACGAAGACGCACGGCCTCGTGTTTCAAGCGAGCAGCG
AGGACGGACTGCAAGGCTACTCGGACGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGTACGAGCGGCTACGCGTTCATGATGAACGGCGGATGCAT
CAGCTGGCGAAGCAAGAAGCAGCGCACGGTGGCGCTCTCGTCGACGGAAGCCGAGTACATGGCGCTGTCGGAGGCCACGCAGGAGGCGGTGTGGCTCAAG
GTGTTTCTGTGCGAGCTGGGCGAGATGGCGAGCGATGAAGGGGTGAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGGAGTTCC
ACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTG