Description :
From Genome Similarity Track
Location :
Scaffold_3:1191659- 1194760
Transcript NameFunction/comments
Physo_494746Zinc (Zn2 )-Iron (Fe2 ) Permease (ZIP) Family
Physo_416471serine protease family S01A, putative

Sequence
3101 bases(100 bases per row)
ACAGAGCCCTGAGCACCGAAAAATACGACATTTTCGCACTCGATAAAATGTAAGAGCATCAGAGTCATCAGCACAACCGCCAAGCCCAAGGAGCCATACT
CCTCCACGATGGAACCAAGAGCCTCGTCGCTTAGCTTCTCGATGCCTTCGTTGATCATGTGAATCAGGCCAGTCGCCAATACCACACCAAAGGAGAACGC
ACGAATGGACTCCATGACGATAGCATTGACGCTGGACTGGGGAATGAGCTTGGAGACGAGAGGCACCAGCGTCCCGGCTACAGACACGGCGAGAATGATG
AAAATGGCCCCGACATGCAGCCCCAGATCCTCCATTAAACGCGTGCGAGTTCGCGCCTTGAATTTCTGCCTGCCAGCCAGTCCAGTGGAAAGAAAAGTGA
TAGCTGGTGGGGCGCTCTAGCCCCTGAATCTAACATATAGGCGTTATGAACTTACCTGCCCGTGCGCGACGTACGCGGGTCGCATGCACAATAACTCCAG
CGCTGGAATACTCCATACGCTTGGCCACAAAAAAACAAAATGGTACTGTGGACGCCCCAAAAACAAATCTGAGAACGATACAGCAAATTTAGCGAAGCTT
TCGTCGAGTATGGAGCCGAAAAAGCTGAAATCGTGTCATGTTTGCTGCCCACCCGCCTCCATTCATTCGAATGTTGTAGCGACGATGCGTTTGTGGACAC
ATTTTTTGTTAAAATGGTACCGCCAATGTGCAAATTCCGGCAAAGGACGATAAAATGAAAAGTTGGTGCTCCATTTCTCAACGCCACAGTCCGTTTCAGT
TGGAGGCAGTGGGTCTGCCGCCGTCGGACAAATGATACGTCGCACTCTGAGAGCTTACGCGAAATCTCCCGCAAGTTGCAACTCCCGCTTTCTCCGACGG
CGGAGACAGTTTGCATGTCCAAACCGAAGAAAATCAGCTCTATCCAAAGCACAATCGAACGGTAGCATGTCGAACGGTAGCACTGCAGTACTCTTGCCTT
GATATAACGAAGAAGCTCTCGTCGGCACACCAAGAATTACATCCCTATAGCCCAAAACAACATTCTAATGAACTTGCTGCAGTATAAGATGAAAAGTACA
CACTGCTGTACGAGTGGCTGTTGTGCTGGTATAAGCGGTAGCATAGTTACAGGGATCTACATGAACCACAATAGCAGCTACTAGCCAACACTAGGAAGCG
AAATGCTGCGGCTATCGACTGCAACTTGAAGCTTCAGGAAATGGAAGCTGTGATTGGACGGACGTTTTGGCCAATGAACAGGATCAATCAAAGATGGCTA
CAGTCCCTAAAAATAATCACGTGGTTGTGATTGCACGACAGGATTCCTGTGTACCTGTGTTGTACATGTACCGTATTGGTATAGTGGGAATGGTTAGAGC
AACCATAAGTATGGTTGCTTTTAGCCATTCTGAGACATGTATGGTTGCTTTTAGGGATTTCAAAAATTACGAGCGTAATTTAAATGTCAAACTTTCAAGG
TCGTCCTTAGGTGCGTAAATCATTTAAGTTCGTAGTTTTAAGTTCGTTTGCATTTAAGTACGATATAAATAAGTTCGGTCGCCTTGAGCCGCTCATTTCC
AAAAGAGCGCAATTGGACGGAGGCCACGTGGATCACGGATTCTCGCGCATCAGGAACGGAACTGAGACAGCACGCGGCGAAGAGGAACTAGTGGCCCCTG
CCCGGAGGGCCACTATGCACGGTACGCAGCAAGTTTTACTCACGAGCTGACGGCAGGAGGTTTGGAGTGTCTTATAATGCGTGTGCATGTACATTAAAGG
GAGGTCTATGCGGGAGCTAAATGACGGCATCGACTACGTGTATTCTGCCCTCGGAATGGAAAAGGACGACGAAAAAGACGAAGACTTCGTGGTCGAGGAC
GGCGAAGAGGATGATGATGAAGAAGAGGCGCTCTCCTTCGATGAATCTGACTCTCGATCAAAAGCTGGTGAGGCCATGAAGTGTACATTTGCCGACACTT
AAAGTATTTAAGGCTGGATATTGTGCGATGTGCGTGTTTTAGCAGGAAAGTCGCGCAAGGGGAAGAAGCAGAACCACACAGGTGAACGAGGACGAAAGAT
AACCCCAGGTATCGGCGAAGACAGTTTCGCATTATGTGGTTGCTTTATTATGCATCATTGACACTGCTGAACCTTTGCTTATCTGTGTAGGTTCTGTGCT
CGACAAAATGAAGTCAACCATGGCGATTCCTCATGATGCTCCAATTCATCGGCGAAAATGTGAATCCTGTAAGGTCATTCAGAGTGTTGCTTGTGACCCT
GACAACGGACGATTGATATGCGTTTGCAGTGCACAAGCAGCGCAAGAATTCCAAGAACAGAAGACAGCAGGAAACACCAAAACCAAAGCAAAGTATTGTT
AAACTAGGTTCATTATGATTGCTTTATCATTTAAGGTCGCTTTAATATCATGTATGGTTGCGTTATTTTTGACTATAGTGCCTGCTAAGCGTCGGATGAA
TGAGACGCTGAAGCGTCATTCTCCTCATGTGGTGGAACATACCTCTCCATCTCCCCCTCCATCTTCTCGTCAAGGCACGAAAAGCTCTGGGCACGGCCAA
CCACTCCCGTTTGACCTTGGTAGCGACAACAGACTCTCTAAGCGTCCAAGTTCGGGCGAATATATGCCGCGTAAACGGCGTAGCAAGTATCCGGATACGT
CAAAGGTCAATGAAAAAGAGCTGATCGAGAATGTCGCTCCGGCGTTTGCTCCAGAGACATGCTTCGCTCGCTAGACTTTAACGGATGCTAGTGTTTCTTC
CAAGCACATCACGAACTTCCTGAATGAGAGAATCGGTGCGTAGTTTTATATATGATATGCTGAAGTGATACTTACGATACTGTTCGCGCTTTGTGTGTTT
GCTAGGCTGCAAAATAACACCTCAACAGACCCGTAATCTGATCCGCAGTATTATGGGGCACGACGCAGCGGAGGCCCGTTTGAAAGACATGCTGCAAGCT
ATCCGCCAGTTAGACGGTAGTGACGTCCTTGTTATTCAAGACCAAATGGACGTGACATGCGGTATCGTGATGCAAACAAAGGTGCAGAAGTTGATGGTCG
A