Description :
From Genome Similarity Track
Location :
Scaffold_144:11916- 14384
Transcript NameFunction/comments
Hyaar_Emoy2811024hypothetical protein

Sequence
2468 bases(100 bases per row)
GCCTACCATTGGCCTAGATGAGGTTTCGTCTCCCTCTACGGCGCAGTCCGTTGTTGGTGACAACGCTGCGAGTGAAGGTCCGACGCCCTCGATTGCGTCT
CCAGTCGTTCCCGTCACTTCCGCGGTTGAAGGCCCGTCGCCGTAGGCTACGTTTTCCGTCGCTCGTGGCACCTCCACAGTTGAAGGTTAGATCGCCTCCG
CGTCGACGTCTGCTACTACGCCATCCGACTCTGGTAACGCCACTATGAATGTATCCCGGTTTCGCTTCCGCGACGTCTGGTGGCGATCAGCAACGTGAAC
TCCGGTTCCATAGGAGCGATTCCGTTACCGACCGCCCAAGTCGACTTTGCCGCCGATCGCTAACCAAGCATCTGTGGTTGACACGATCGCTGGCCTTTAT
CAACGGATCAAGTCCCAGCACGACCTTGTTAAGAGTTATCGTGATCTGGAGCAAGCGATGAGGGAAAAGACCCGTCGATGTGATCAGCTAGAGTAGAAGC
TCCGTTCCCTTGCTGAGCCGGCTTCTCCGTTCGTGACTTTTGTTCAAGTCCGATGTGATCGGCTTCGCCTTGATCTCGAAGCTGCACTCGCGGAGGCCGC
CTAGCTTCGGGAGAAAGTCTGCGCAGGGCAGTGCCAGGAGCAACAGATCGATGAATTGAAATTGAAGCTTCTGAAGACAGCTCGATCGCTTCATGCTGCA
CAGGAGCATCATGATCGTGAGCTGGCACCCTAACGGAAACACATGGATGAGGGAAATGCCCGAATGCACGCCGAGCTCATCCAAGAAACCTAAAAACTTC
AAAAAACCAAGTCCAAGAAAGCCAAGTACAAGACTGGGTTCTCTCAGACTCAGAACAAGATTCTCAATCTACACAATGCTCTCGCGGTTTTGGCGATGGA
GCGCGATCAGTATTGGGACGATCTGGCTGAGATGGAAGCCGATCGCGATTGGTTACGCTCCTTACTTTCCGATCAGGACGACCAGGTGGGTCGGCTCCAG
ACCCAGATCTTGGATTTGGAAACCGAGCGCGATCGAGAATTGCACGATCGCGATACACTTCGAGCTAGTATCACCAATTTGGCACTAGCCTGGCCATGCC
TCCTTCGTCCAGTCCTGTCGTGGTGGCTTCATCCCTCCCTGGGTCATCAGGCGTGAAGGATTCGGTGGCACCCCCGAATATCCGCAGCAAGAGTCCCAGA
ACTTCCGCTCCATTTCCTCCCCGTTTGAACAAGACGTCCAAGAAAGGTACTCTCGTCCGACCCGTCCTTTTTTGCGGTCTTCAGTCAATCCGACACCCAA
AACTTCCGTTTCGTCTGTGTCTGGTGGCCCCACCACGTCTTCTCTTCCAAGTAAGACCCAAAAAGGTGCTCCCCATCCATCCCGCATTTCCAAACGGTCC
CCAGCAAAATCAATGTCCAAGACGTCCGTTTTGTCCGGGTCTGGTAGTCGCAAGAGCAAAGCCAAACCGAGAGTCCAGGCGTCTGCCGCGTCTAGCTCGG
ATGATGGTGATGATGATACGTTGGATGCGGGGTCCCACTCTGGCTGCACTCTCCCGATCGCGCTCTTCTTCCCGGCGTAGGGTCCAGCCTGGTAGCCCGC
TGCCTCCGTCCTCCGCTTCGCCAGATTTAATCGTGGTGGACACCCCAGCCTCCCCGATCGCTACTCCTCCCACGCCCAAAGCCAAAACTTCCAGGCTGGA
CTTGTTTGGTGAAGCTTCTAGCAGTTCGGATGGCGCGATCAGTGTTGCGGAGGAATTCCGAGCCCCAGTCAATACGTTGTCGCTCCCGGCTGAATATGAT
GCTCTTCTCAAGACCAAGGTGCCCCGATCAGTGGATACCTGGGTATTGCCGTCGCATTCCAAAATCTTAGATCTAAGTCTCACCTTAGTCCGCGCGACGA
GTGAGCTGGATCAGCGTGTCGGAATTGGACTTAGATTTCTTCTGTCGACATCTCGCAAGACCCAATCATTACCCCTTCCCGTCTCCTCCCGTTGTGTCGA
AACCACCTCCAGTGTCGGAGTGGCTCGCTCGCCTGATTTCCTCGGCATAGATCGACACTCTTTACCGCCAGGAATCTTGGAAGTCTCTAAAGACAAGGAT
CGCGCATGTGTCTTTCCGGCCGATTGGGTGGGGTAAGCAGTTGCTGGATGTACCACTCCTTCGAGGATCGCTATATCGAAACCTTGTGAGAATCGACCCA
CACTTTGCCGATCTCCTCCGCAGATCGGGTCCGCGATCCGGGGTTGGCTTCACATTGCGATCAGCGGAAGCAACGGTGATCGCGAACTGGCCCCCGCTGG
AAAACAGTTCTCCGATTCATACTCCAGGGTATGATTGAAGGCCATTGTGACATGGACATTCTGCTGGACCCGGTTTGCTTGCATCTGCCCCGATATCCAA
CTACTTCACCACATATTTTCTCTTTCATTAATACTGATGTAGACGTTTCGCCGGTGTGTTATGGTACG