Description :
From Genome Similarity Track
Location :
Scaffold_320:11914- 14009
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_320-fgenesh-gene-0.6HECT ubiquitin ligase

Sequence
2095 bases(100 bases per row)
TTACGCGGTCGTAAAGCCTGTCAGGTCGGTATCGAGCGTTGCGAGCAGCACAGTTTGCAGCTCGCTCTTGGATCGGTACAGCGGCAAGTCCAGCCGGTTA
AAGCACGCGTGGCTCGAGATGTACTGCGTCGTCGTGTACGGCACGCCCCGCAGGTTGAACGGGCACAGCCGGCCGTCGTAGCTCGTGAGTCCCGCGAAGC
CCGAGATCGGAACGCAAGCCGAGCCGGTGGCGAACAGCAGCAACCGGCGCCGATACTCGTTCGGCATGTCGGCGACCACCTCCCAGAACCAGCGCAGCGC
ATTTGCGCTGTTCAAATTCGGCGAGTGCGTCGAATCCGCGCGCCAGTCGACCACGTCGATCTCGGGCGTGCCGCACAGTACGTAGTCGAACTCCTCCGGG
TCGAACGCCAGCAACTGCTCGGGCGGCACGACCTCGTACACGCCGCTCAGGAACGCGTGGAGCTGGTCGCCCACGCTCTCGAACAACATGTGCTTGAACC
ATCGGTCGGCATATTCGCGCTTGTTGGCGTCGGTCACGTCGATGCTCTGGCCACCGGGAACCAGCTCCACCACGTGCAGCTCGCCAGCCGCACTGCGCTC
CGTGACGGTGAAGTCGAGGCCGAGAGCGTCGGCGCCATCGTGCTGCAGCATCCAAGTCAGATGTTTGTATGTCTCTGGGTCAAAGTACTCGACGTCGCTA
AAGGTGACGGGGACGCCGAGCATGAGCTTGAGCAGCGGTCGCGCAAGGTGGAAGCCCCAGATGCCGCCCTCGAGCAGCGCACGACCGACCAGCCGGCCCG
TGGAGAAGTAGAAGCGGAGATGGTCCTCGCCCACATCCTCGCGCGATCGCGGGTTGAAGTAGAAGGCGCCTTCACCGCGGTTCGTGCACACGAACAGTCG
CAGCGTCGGGTTCACGAGCAGCTCGTTGAGCAGCATGAACCACTCGCGGTGCACGCCTCCAGCGTCGACGCCGCTCTCGTCCAGGAAATTGATGCGCATG
AAGGACCGGATGTTCTTGGGCTGGATGCAGCACATGTGATCCAGCGACTCCTCCAACATGTAGTCGCGGTGCACCGAGAGCTTGAGGAACTCGATCTCGG
CCGGCAGGATGAGCGACGCCGTCGTCACCACGAACTGCGCGTACTTGGTCGGGAAGTCGCTCGCGGCGAACTCGACTGCCTCCTTCTTCTGTGCCACTGA
CGCGTGGCTCAACGCGCTGATCCCGGTCGGGAACGTCGCCGGGTCGGCCGCCGACGCCTCGAAGAGCGTCAGCTTGACACCAGCCCGAGGCAGCAGCGAT
GTCTTGGACACTCTCGCCTGTCGATCGACGACAGCCGCGACCGCGTCGCCGTCCTCCTGCTCCTCGTCCTCCTTGCTGGCTTGGAGTTGGGCCACATACC
CCGTCTCTGAGCTATCGTGGTTCTGCCTGTACCAGAACAGGTTGCCCTCCACGTCCAGGCGTCGCGTCCACTCCTTGCGCTTGCTGCCTCGCCAACAAGA
CGATACCTCCATGTTAGTCCCCTCACCCACACCAACGGCGGTAGCATCCGTCACTATACCTTGCGCGGAGCTGCTGCCGTGTCCGCGTGGCCGCCGAGAG
TCTGAACGCGAGCCCGNNNNNNNNNNNNNNNNNNNNNNNGCCGCGTCGCCGTCACCAGCGTCCGCCTCGGGGTTCGCCGGTAGCTTCTCGCCGCACAGCG
TGCAGTACGCGAACCGCGTGAAGTTCTCGAACGCGCAGCAGTCGCACACGGTGAAGCCGGCCTCGGCGTCCCTGCGCAAACGGATCCATTGGTTACTCCT
CAAGCTCAGCAGAGCGATCCCCACGAGCGACACGCATACCTCGTGGCCGCGTCGATGCGGTGGTCAACCGTCTCGCCGCTGAATGTCAACAGCCAGAACC
ACGTCAGTCGCGGATGTCGCCGTCCTCTGTGTCCATACCACGGGGACTCACGAGAGCAGCGGCGCATCGAGGCCCTCTAGTCCGCGCGGCCGGCGGTGAC
AGCCGACGAACCAGCCGACGAGGAAGACGACGCAGAGCAGCATCATGCCCACGCCTTGGTACACCATCGACAGCTCCAGCGACCGGTCCGCCATG