Description :
From Genome Similarity Track
Location :
Scaffold_14:119125- 120518
Transcript NameFunction/comments
Aphas_H257_06124mitochondrialprocessing peptidase subunit beta puta

Sequence
1393 bases(100 bases per row)
CACCCAGTACGAGCGGCGACGGATAAAGTTGTAGTCGGGCAACTCGTGGATGGGACCCACGGCGGCCAGCGCATGTTCCTTGTCGTTGATCACGTCGTCA
GCAGTCTTGCGAACCGCGGCGGCGTCGACGGCGTCGATGCGCGCAAAGATCTCGGCGGGCGTCAAGCGGCGTCCGTACACCAACAGCTGGCGGCCAATGT
CTTCGCAGACGGGGGAGGACCCGTCCAACTGCATGAGGATCGACGCCTTGAGCTGGGTCTTGGCGCGCTCGACTTCGTCGTCCGTGGTCTTGTGCACGAG
GCGGACCAACGCTTCCATCACGTACCACGTCAAGTCGTTCAGCTTGTACTTGTCCGCGACGGCATACACGCCGAAGATGCCCGTGTCTTGGTAAGACGTG
TTGAACGTCATGAACGAGTGCGCCAGCTCCTGCTCGGCCACCACTTGGCTCAACTTGGACGACGCGTTCAGGCCCGCGCTCGACGTGCGGTCCCAGCTGC
CAAGCAAGGTTTGCATGACCAACAACGGGAACGAGTTCTCCGAGGTCCATCCGTACGATTCAAAGCCAATGGCCACGTGAGCCAACGGAAGGTCGTCGTC
CTAGTGAAGACATGTATAAGTACATGGAGGAATCGGCGCGGTTGCATGACGTACACGAATGCGAATGTCTGACCCGACAAACTTGACGGGTTCGAACGCA
GGCACGGGCACTCGGGGTTCCGTCGGCAAGTTACCGAACGAATGCTGCGCCAAGTCGACCAACTGTTGGTGGTCGACGGCACCGGCACCGGCAATCACCA
TGCGGGGCGCGGTGTAGTGGGTGGCGATGTAGTCTTGGAGGTCGCCCTTGGACAAGCTGCGCACGTTGGCTTCCGAGCCCAAGATGGTGCGACCGAGGCC
GTTGCCGAGGAACGCGGTTTCGTGAAGGCGGTCGAAGATCACTTCTTCTTGTTGCTTGTTCACTTCCTCCATTTCGCGAAGAATGACGTCGCGTTCACGC
TCGATGGCGGCTTCGTCGAGCTTGGAGTTTTGCAAGATGTCCGACAAGATGTCCAACGCTTGAGGCACGTCCTTCTTGAACACCTTGGCGTAGTACACGG
TTTGCTCGCGCGAAGTATACGCATTCAAGTGGCCGCCCATGTTTTCAATCTCGACTTCCAACTGTTGCTGGGTGCGCTTGGCCGTGCCCTTGAAGGCCAT
GTGTTCCAAGAAGTGTGCGGCACCGTTATTGGCTTCCGTCTCGTAGCGGGAACCGGCACCAATCCACACGCCGACCGTGGCAGTTTCACCGTGGCCGCCT
TCCGACGCCACGCGCAAGCCGTTGGCCAACGTCGTGACTTCCGTCGCGGGCGCGTTCAAGACGTACGCGGGGAACGAGGAAGAAGGAGCCGCC