Description :
From Genome Similarity Track
Location :
Scaffold_712:11911- 13532
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_712-snap-gene-0.2Conserved gene of unknown function

Sequence
1621 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAGAACTGTCCGtCcAaCcTGgCTCCAACcGTTtGcTGCtgTTTCCTCTTCGACGCCGCCGCTGTCGTGATCACCAGCACC
AAGCTCTTCGGGCGTAAAATGGAGAGGCAAAATGTCTTCtgCTTGAGCgCCGGTGGaGACGCCATCACTCGTGCCGACGTCACCGCTTCCCTCcACACGC
TgTTGgCCTTGGTCACGCGTTCATATTCCTCCACTTCCGAGTGCATCTGGCAACCCAaGATGCAGAGCTGCAGATGGCTGGATGTTGGGGCGTGTGCCGA
ACAGATCAATCATGCGATGAAATTGTGGACAGAGCTGCTCCAGCTTCTCAGGGAGCGAGATCTGCTTGCGTATATCGGCCTTGGACAAGCCTATTCCTGT
CTCAGTTCTGCTTCGGGTGTAGATATCTTTGAGCCGCTTGACGTGGTGCTCCCATCGCGACTGCATACACCGGCCGGTCAGTCGCGCCAGGTCCTTCGTC
GTCGAGTGCTTGTGTAGGTGTTCCGCCATCTCATCGTAAGCAGCGATCTTGGTCTTCTTCGGACCTGGGCCGACCTTGGGAGCCCcTTCGGAGCCGTAGA
TCTTTTCAAAGTTCTTGACATTTTCAAGCCAACAGACAAGAATGGGGTAGTCGTCGGCCGTGGGATGTGTCTTACTCTGCACAGCAATGTAGTCGGCGAG
TAGCCCTGCTGGAGGCGGTGACGGCTGTTGCAAAaTCACCATGCCACCTCTGCTCGTTtCCCCTCTTGCTTTCCTTTTCGTGTTTGCCGCCCGTGAGTTT
CCGCGCCGAATGGGAACaGGA