Description :
From Genome Similarity Track
Location :
contig_78:119108- 120982
Transcript NameFunction/comments
g12554.t1hypothetical protein

Sequence
1874 bases(100 bases per row)
TTCTACTGGCACGACTTGCGAGCAGCACCCAAACTCATGTCGAAGCGGGTCAACGGTGGCGGAAGCGTCATGATTTGGGCGGGGGTGAGCTGGCATGGCA
ACACCGAGCTGGTCTTCCTGAAGGGGAAGCAGAACTCTGTCAAGTACACCGAGACGCTGACCTCCAGCAGCTTCCTTGCCTTCGAGAACTGGGGTCAAAA
TTGGCAATTTGACCCCAATTTTCCAGCAGGATAACGCGTCCATACATGCCTCGAGGCTCACCAAGGGCTTCCTAGCCACCCATAACATCGAAATGCTGCC
GTGGCCTGCCAAGAGCCCCGATCTGACATCATAGAGAACGTGTGGGGGCTCCTGGCTCGCCGGGTGCACGCCAACGGGCGCCAATTTGACAAGCCTGCCG
ACTTGATCAGACAGATCAAGTTGGAATGGTCTCGCATTGATCCTGCGTATGTTAAGAAGTTAGTGCGAAGCGTCCCGAAGCGTCTAGAAGCGACGCGGCT
GTTAAAAGGAGCCAAGACAGGTTACTAGAGCCGTTAGCATGTAGAGCCTCCAAGTGCGGCTATACTTCTGACCCGACCTGAAACCAGATTTTGCCTCCTG
GCTCCAAGCCATCTTGGTCTTTTTCAACTTCGCTTGCTGTATAAGTTTTCTATTCCTTTACGACGGCCTCGGAGCCCTCAGTTTGCAGGAAGTTCTCAGT
TCCCGGCGCAAGAGCTCCGCTTGTCCGGTGCGGCTATAATTTCGGCGCGTACTGTATGAGGCTGTAAGTTGTAGACTCGTTCGCTATTCACGCACATTAC
TATATCACTTTGCTTGCAGTTATTCCCAAGATGGCCGGGCCAAGGTGTAGAAGGAAGATGAAAGGCCTGAACTGCCAAACAGCTTGTCGTGTTCACGAGG
TTTTTCAAACGAACACGAAAAACTGTTTTTTCAGCTTCGGACGAAAGGTTTCTCGTAACCACAAACCAACATTTCGGTTCGTTCTAGAGTAATTTGGATT
GATACATATGTTATGCTTTCCAGATGAGCAACCAAGCGCGGCTGGCGCAATGGATAGCGTATCAGACTTCGAATCTGGGGGTTGCGGGTTCGAGTCCCGC
GTCGCGTACATTTTCTTTTTTGTCACGGCATCTGCACTGTTTCGACGAAGCCAGCAACAAAACTTTCATAGTTGTCGTTTTAGTCACCGGGCAGAAGGCG
TATGTACATGCATCTCAACGCAATTGCGCGATGTGAAGCCTGTATATACACGGGAGATATCAACGATCGCCCTCCTGCGAAGTGCCCTCCCATAGAATAG
GCGCGATCCCGCGACTAAATATGGTAAAGGGTAAAACGAACCGAAGCACACAGCGTCACGGCGAAGGCAGAGACGGAGCCGAAAGCGTGAGGGCAATACG
TGAGACAGAAGGTTCTATCTCCATATCGCGAGCGAAGCGCGGCTGATTCACTATATATTCTTCCTTTTTATGTATGAGGTCCCCCGTCCATTTCCCTCAT
AGATAGTGTTTTGTAGTCTTGGCAGGCTCGTTTCCGCTTTCTCGAGTTGTTCGCGATGAGACAGGAGCGTTCGTGTACACTGGCTGACCCGACACAATGG
CCTCCAACTGCGCACGAGTTGTCTGTGCGTCTCCACTTCAACAGCTTAGAAACCTATTTTGCAATGTTACAGAGTTTTCGGTGGCACTCGACTCTTAACG
CTGCACAATCTGTCTTGTCTCGACGCCACAGTGCGTTTCGCTTTGAACGGAAGCATGATAAACTTTCATCTGCCGGCTCACCCCTGCACGGCCCTCATGC
ATACCGAGAAGTCGGAGGCTTACTTTTTGTAGGGAAGGGCCGGAAAGCGACCACGCAACATACAACACAGCAAC