Description :
From Genome Similarity Track
Location :
Scaffold_888:11909- 13317
Transcript NameFunction/comments
Phyag_g8563hypothetical protein PHYSODRAFT_495212

Sequence
1408 bases(100 bases per row)
TGCGGGTAAACTATTGAAACCTTGACGAAGGCTAGAGGCCAGTCGCTTCGCTCGAGCCTTTTCCGCCTTTGCGTTCTCAGCCTCTGTGCCATAAAGCTGC
TCTGGATTGATACCAAGCTCGTCACGTAAAGGCGTACGCCCAGCAGACATCGGCGTCTTCTCGTTGACTGCAGTAGACACAGCCGACGAGGGTGTTCGCG
ATGGAGTTGCCCCCGCATAACCTGTTCCTTCGTAGAGTTCAACATTctcgccaccaagaagaggagTGGCGCTGTTTCGCATGGCAAGCAGGTTTGCTGT
TTCCTGCATAATGCTGTCGTGTACGCCCCGACTAGATGGAGTAGCTGCTGTACCTCCATTGGTAGAGCGTAGCGGGGTAGCACTATAGTCACCCATGAGT
GCCCGCGTCTCGGTAGCTGACCCGTTctcaagagcgagagcggCAGCGTGAGAGGCATGCATGCCCAGCTTGGCGAGGTCGCTCAGTTCGTCATTGGAAA
CCACTGGAGCAGGTAACTCCAGCGGAGTGCGCTTGATCGCGTTGATGGGGTCGTTCTTCTCATTTACCGCAGCGATGATCTGCGGCAGGTTGGATTTCAT
GAGCGACTTCTGGCGCTTGGCATCCTGtttgcgctccttcttctcttgggCGTCACGACGCACTCCCTCCAGCTTGTCCAGTTGTAATGCAGCACGTTTG
GGGTCGATTCCTTTGCTGGAGAtgcgcttctcctctgtGACATCATAAAAACCGGCAggtgccttcttctcgaacgGGATCTCGCTTCCATAGTCGATGA
ATTTGCGTTTCTTCAGGTGCACCTTTGGGTTGGCCGACATGATCCCAGCCGCCTTCAGCTCCCGTTTCTTCTGCAACGTCGCGAGTCGTCGcgcctcttc
cagctgcttctctcGAGCCTTGCGCTTGGCTTTCTTGCCCTTTGTATTGGCAAGACGAGCTCTCGCCTCCGAcagcatctccttctcgtcttcgtccatg
TCCACGGGGTCAGGTCGCGCCGGTTTGTTCTCCGGATTGGGGTCGATCTCTCCCGGTCGCAGACGTCTCGGGTCGTCACTGACTTCGACCCCCTCCTTCT
GTTGAGCTGCATCGAGCAGTCGCTCGTAGTGCTCCATGCACTGGGCAGCAGTGCGTCCCACGATGGGGGCGATGGTGCGCCACTGCGAGGGCATGAGCTT
GGCTAGATGCAGCagtttctcctcctcctcgcgaCTCCACTCGGTCTTCTTGATGCTCGGGTCCAGCCACTCGTACCAGCGCGCCTTGCACTGCTTGGCC
GACTTgcgcgacagcagcgaggcCACGCGCGCCCACTGGTTCATGCCGTACTTCATCACGGCCGCCTTGAGGATCTCATCCTCCGTGTTCTTCCACACGC
CGCCCTTG