Description :
From Genome Similarity Track
Location :
scaffold_21:1190706- 1192812
Transcript NameFunction/comments
Plaha_PHALS_10436hypothetical protein

Sequence
2106 bases(100 bases per row)
CTTCTTGTACATCCACTTGGTATACAAGCAAACTGCACCAGGCTTGCACTCGACGAGCTTTCCCGTGTTGTTGGCTTGCAGAGCAGCTAGCTCTTCCTGT
TCAGCCGCCGCCCACAGTGCACTATCAGCACACTTGCACGCCTGCCGAACGTTTTTCGGCCTCGGGTCATCAAAATGCGGGTTAACGGCATTGGTTTTGG
AAGCTGTAAAAGCTAAAGATCCACTGGGTAATTTGACTCGCTTATCTCCGCATCACCACCAGCTTCAGCACGGCGGCGTGACTTGCGGTGCGGCTGACGA
GATCTTCGGGTTTGCTTACTACCTCACTTTGATGCCTTCGTCGTGGGCATTCAAGCAGCTGGTGTCTTGGCGCTTGCGTCCTCCTCCACTGTGCATATGT
TTTGCACATGGCGCGTGACAATCACTTTGCTTTCCAAAGTTCTACTTTTGCTTTCGTTCTTTCCCAACAATGACGCCCTCACACGACCTCTTGTTCATGG
CGAGCCTACCAGAGTCACGAAGCACAGAACACTTGGATACGGATACCACGATGTTACAACGGGTTGGCGCTTAACAAAGAATGTCTTGAGTGGCGCCTTC
CGATCCTCATTGGCGCGTGACGAGGTCCGGTTCAGTACGTTTGTGGCGTACTCAGCTGCGTCACCCCATAAACTGAGCGGCAATCCTGCGCAAAACACCA
tggccgttcggcttccagacccaaaacgtgggtgtcgaatgacgagacttgctctcacgcaccatttctgtCTCGagctttgcacaaaaaaaggcgtcaa
taacGTCACATTGCTCCTCCGGCAGGGGCTATCGACGTGCTACGCAGTATCTGGTTCCTGGACAACGAATCATGTTCAGGATTGTGCGGTGCATCCGCTC
CGCTTTCCCATTTGCAGCTTGATTCCGACTTCAGACACTTGACGGACCACTCtgttttctttgcaaaagagATCCACGCTTTGATTTTCTCCTTCGCCAT
CCGTGCGGAGAACGTGTATTCAACAGCTAAACGGTTTCTCAAAttcaacaagaaattcctcAAACTTTTTGGCAGCCAGGTTCGTCTTTCTTGCCATGAA
CACCTCGCAGTTGTTTGACTTGTGGTCCACGAAGTTGACCATATATCGATTACCTTGACGATCAAGCGGTGTCATCGGACCCTTCGAGTGGCTACAAATG
ACTACTCCGATTTTGTCAATCGGTGAGTGCTTTGCAATGACCTTGGTCGGCTGTTTTGCTCGAGTTTGCTTGCCCTCAGCACAAACCAAACATGGTGTCC
TCCCACGGTTCGATATCTTGATACCGGATGCAGGGTTTTTCACCATGCCCTCAATGCTGTCCAGCGCCAGATGACCAAAACGTGCGTGGATCCCCATCAA
GGTATCCGTGGTGACGATCGACGAGACTGTGTTCGCACCACGTTGATCGGAGCAAATCGCACATATACGGGAATATGTCGTGAATACGAAAGCTGCTACC
GGTTTCGAATGAGAGCTTCAGATTGGACGCATTGAAACACTTCTCGGTGAGAAAATCAAGTATGAAATGCCAAATGAAGCtcatatcattttttttcaat
gacAGTAAATACAATTTGCACCGCACGCGGTAAGATAGATTTGGTGGCGCAAGGAGTCGGAACACCCGTCGCAAAATCCCCTCGTTTGGTGACGCTGTTG
CAGCGCGCTTTTGCTATGTTTGGAGTAGGGCCAACTCCATGGTTACCTCAACATTTTATGAAAAGTTCTAAAAACAGTTTTGTTCCATatagacatgcag
aagagtTTTCCTGAGGAAGTCGCACTTGTAAACCCTCGTAGCTCCGGCCAGGCAATCGCAGCTTCTGTGTCTGTGACGGTTAGTAAGTATTTTCCCGGGG
ACAACTAGAATATAAGCGGTCTAAGTGCTTCTTATTGACACAAGGTCAAATGAGTGAGTGCTTCATTCTTAATCCTTACAGTGACTAAAATATCTCACGG
TGAAGTCGTCAtattgacgacaagtgctACAAAGCGCTACGATAATACCGTGGCCCCTTCCACAGAGGACGCTTTAAATCGAAGGGTCCACGTTAACAAA
CGCATA