Description :
From Genome Similarity Track
Location :
Scaffold_170:119027- 120609
Sequence
1582 bases(100 bases per row)
CAAGGACTTTCGCGCCGTGGTAGACTTGGACGAGAGTACAGTTACGCTCAAGGACACGAGAGAGGTGTTCCCTATGGGGTCTCCTCGGGTGGAAGAGTCT
TACCTGTCCCGCATCTCATCTACCATTCGGCTCCGCCCTGGTGGACAAGCTCTAGTAGTTGCGGAGGTTCAAGGTTTACTGAGTGACGGAACTACCGTCC
TCATAGAGGGGCTTTCTGCGCTGGATGACTCCATTACAGTTGCTAGGACCCTGTGCACTGTGTATAGCGACCTAGTGATCGTGGAAGTATGCAACCCCTC
TATCGAGAACACAGTCATCAAGAGAAGCACTAGATTGGCGAGTGTTACGGTAATCCCCGATACTGCGCTTCAGCAAGGCGCCACTGCGAGTGTGAAGCAC
GAAACCGCCCTGCCCGACGAGGCCCAGACTATGGACCGAGGAGCTCAAGACCTGTGGGTCCACTCGGTCATTAGCGCCTCTAATACGACGACCGAAGTTG
CTCAAGAATCCGTACCTGAGTTGGACCGAGTACTCAAGGAGGAGCTCCACGTCGACCTGGACGAGTCTAAATTGGGGGAGCGAACAGAAGAGAATATTCA
CGGAGTTTCTCCAACCGTTCAAGGACATGTTCGTCGAAACTTCGATGCGCCCCGGACGGACGAGCCTACTCGAGTTTTCTATTGATACTGGAGAGCACTT
GCCTATAAAGCAACCCCCTTACCGAGTGTCCAAGGCGGAAGGAGACGTGATGGAGTCCGAGATACAAGAATACTTAAGGCAAGAACTCATACGACCCTCT
TCTAGCCCTTGAGCGAGCCCGGTGCTTATGATCCGCAAACCTGACGGCGGGATACGGTTCAGCATCGATTATCGAAGACTGAACGCTGTGACTATCAAGG
ACTGCTACCCGATGCCGCTCATCGATGACATTCTAGATGTACTAGGCAACGCTAAGCTGTTCTCTACAATGGATATAGCATCCGGCTACTGGAATGTCCC
GATGGCAGCTGATAGCGTGGAAAAGACTGCCTTCACCTGCAAATATGGCCTCTTCGAGTGGCTCCTAATGCCGTTCGGGCTGTGTAATGCCGTACCGGCC
TTCGAACGACTGATGGAGACTGTGCTTTTTGACCTTACGTGGCGGACTTGTCTAGTGTACCTCGACGACTGCGTGGTCTTCAGTGAAGACTTTCCTACCC
ACCAAGTACGACTAAAACAAGTCTTGGAGCGGTTCCGTTCAGCTGGATTCAAGCTCAAGATGAAAAAGTGTAAGTGGGCTCGTGACCAAGTAGCGTTCTT
GGGACACATCGTCACTCCATCTGGCATCTTGCCCAACCCGAGAAGGTCAAGTCGGTGATGAACGTGCTCAGACCACACGACTTGCACACTGTGAGGGCGT
TCCTGGGTTTGACTAGCTACTTCAGGCGGTACATCCCGGGATACGCGGCCATATCAGCCCCAATCGAGCGGCCCAAGATGAAAGGAGCCCAATTCTGCTG
GAGCGACGACTGTGAGACCGCTTTCCTGCAACTAAAGCGTAAGCTGGTGGAACCTCCTATCCTGGTGTATCTCGACTTTTCG