Description :
From Genome Similarity Track
Location :
scaffold_185:11902- 13094
Transcript NameFunction/comments
Pl_108081hypothetical protein PHYSODRAFT_516871

Sequence
1192 bases(100 bases per row)
GGCAGCAAGTCTTCATTCACTTCATCAATCGACGCGGGTCTTGTACTCTTACGCTGTACCAGCGTCGGCAGCTTTCCGCCAACCTTACGCATTAGTTTGT
GAGCAAGGGATTCACGCCTGTCACGCAATTCACGAAGCAGATTTTGCCGTTTAACCAGTAATTCTGCCCGTGGATCAGCACGAGGGCCGAATCGATCGGA
TGAGCTCACGAGCTGCTCCTTGATAGCTTTTTTCGTTGCTGGTTGGTCTACCTCGGTAGCTTGTGTCTGGAGCTGTTGGTGATACATGCGGACGCAGTGC
ATGCCGTACAGGAAATGCTCAAAGTCCACAAGATCGGCGTACGCTGAGTCGAATGCTTCAAGTAGCTCACGGACTTTTGGTGCCGGGACGTGAACTCCAA
GATCATATACAGCCTGCGCGATTGCTGTATGTGACACCAAACCAAGCTGAGCTGCATCCGCTGCTGCAAACAACAACCTGAAAGCTTCGACCTCCTCTTC
ACTGAAGTTATTGAGTGTTTTGCGCAGGGTTTCGCGCCTCTCGATTGCCCGTAAACGATGCTGTTCCTGTTTGAAAGTCCGGAGTTGACGGAGATAACGT
GCGCGAGTAACTCGTGTAAGCAGACGACGTTGGATTCGTACGGCTGCCGCGTAGCGCAGTCGATCGTACAATGTAAGTGACCTGTCCAATTGCTCGCGCT
CTAGTACTTTCGCGTCTTGCGGACCAATTCGCAACAAGGCACGACCACGTCGGATGATCCTCGCAGCTAGCGTGCGAGACCACCAGTCACGGAGTGTACG
AGCCACTATCGACGCGAAGATCATAAGGGGCTCCACCACCAGCTCCTGAATCGCTACACCCACTGCCCAAGCGAGAACGCAGCGCCAAGAAGTGATCAAA
CCAAGTTCCATCGCACTAATTGCTATCGCGTACGCCATGATCACTAGCCACACGAGGCATATTGCAAACACGACGTATACTATTGATGCCGGGTATGGAA
CGTCGTCTGCACTAGCATCGCCATTCAATTCTACGACGTTGTCTTCTTTGTCATCATCTGCCGCAAGACTGGAGATCAGCACGTGTTCATGCTTCAGTGG
CGCTACCGCGAGCTCACTAGCTACCGAAGGTGCGACACTGTCCAAACTCGAAGCCAGAAGTTGCGAGCGCAGTTTTCCACGAGCAGGAGCAG