Description :
From Genome Similarity Track
Location :
Scaffold_121:119014- 120322
Transcript NameFunction/comments
Phyra_40639PREDICTED: copia proteinlike putative

Sequence
1308 bases(100 bases per row)
CGAGGAATTGTGGTTGGCGCAAGCTGTGCCAACTGCCAAAAGGCTTTGGTCGGTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAA
CTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGAGTTGTTTCAGCCAATCAGCGACTGCCAC
GTGGATGCCCATCTTGTACCCACAGTCTTGTACCCACGTGTCCCGTAATCTCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCA
GCGTCCCGTAAACACAAGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGCTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAAC
ACTCCCACTCGACTCGACAGCGATTGCACCTTGGATCCCGAGCTTGGTCCGGAGCACATGGAACTGCGTTGCAGGAATTGCCTTCGTCATCATGTCCGCC
AGCATGTCGGTTGTCGACACATACTGCAGCACCACTTGGCCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCGAATGTCGATGTGCTTGGTGCGCTTGT
GGAACTGCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGACCGCTTCATCGCTTGCCATCTCGCCGAGCTCGCACAGGAACAC
CTTGAGCCACACTGCCTCTTGTGTCGCCTCCGATAGCGCCATGTACTCTGCTTCCGTTGAAGACAGCGCCACCGTCCGCTGCTTCTTGCTCCTCCAGCTG
ATGCATCCGCCGTTCATCATGAACGCGTAGCCGCTTGTGCTCCGTCTTGACTCGATGTCGCCGGCCCAGTCCGCATCCGAATAGCCGCACATACCAAGGC
TGTCTTCCCGTGAGAACTCGAGTCCATGCGTAGGCGTCGCTTGGAGGTACCGCAGCACACGCTTGAGGGCTTGCCAATGCGTCGGACACGGGTCGGCAGA
GAACTGGCTCAGCACTCCCACTGCAGCTGCCAGGTCCGGACGCGTTGCCACCATCAAGTACATGAGAGTGATGGAAGGTATGGATCTTGACACCGAAGCT
TGACGGAGCGGAGGGAGGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGATTCGAAAGTGATTGATTGAGG
TCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTACTTCAACCAATGAGAGAGCGCC
ACGTCGAA