Description :
From Genome Similarity Track
Location :
Scaffold_4:1190079- 1192764
Transcript NameFunction/comments
Sapdi_VS20SDRG_02117hypothetical protein
Sapdi_VS20SDRG_02118hypothetical protein
Sapdi_VS20SDRG_02119hypothetical protein

Sequence
2685 bases(100 bases per row)
TCTTGCGGATGGCGCCGGTGCCCAAGACATCTTCAAAGCCGTCTTCCTTGCTCATGACCTAGACGGCGCTCCATGAGGGCCCTGCGCCATGGCAGACGTC
AGCAGCATGCTCGTACACGCGTCTCGGATATCCCGTTTCACGCAATATAAATTAAAAAGGTCGCGTGTGGGTGTCGTCCAGCATGGCCCGTTCCGTATAT
CTTTTTAGGCTCGCGAACGCAGGACGCACGCCTCTGTGATTGGTGCTTGCTATGACAAAGATACTCGTCCCATACAACAATGCAGTATAGAAAGGTCGGC
CTGCCATGCACTACGAACTTGGGGCGCACCCAGTTCTTATGTTGAGGTGCAACACAGTACAATAAAAAACGTGGATGTATTTTATTGATATAATTAATAT
CACATAGTCCGTCGAAGTAAAACGTGACACAATTGATTTAATGATATACCGTTTTTATTCCATGGGTGCACGATGGGCGGGTTTGTGTCAGCCAATCAGC
GTGCGTGATTGGGCTCGATTTATATGTTTTCAGAGGGTTTGCATTCAATGTGGGAGGTTTTGGTTTATACTCGGCCAATGTAACGACCAACAGAACCATG
AGTTTTGGTTCAAAAAGGAAGAAAACAAAAAACGAAGTCCGAGCTCCAGCAGCAGCAAGCAGCCCGCGAGCGACCAGACCACGAACGACCCACGGCTGCC
AACCCAACGACCCCGCGCGCCCGCCAATTGCCCCTTCGCTACTACTACCGAAGCGCCATCTTCCCCGCGCTTCCTCTCACTCTACACTTCACAAGCTCGC
CAACGATACCAAGCAAGGTACAGCGACCGTCGCATGCGACCCATTGATGCAGACGCTCATGGGTGCTGGCCGTTGTAGGCGCCATCATGACCACTGTCGA
CGTAGCCATGGCGTCCATTCCTCTCACAGAAAAGGCCACGCCGGTCGCCCAGCGCAGCACGACCAGCGACGGGTCGAAATCCAAGACCAAGGACAGCGTG
TACAAACAAGACAAGGCCGCAAACGCCAAGAAGATTGTATATCCCCCGCGCCTTCTCGTTGACTTCAAGTCGCTCCAGGTAGTCATATCACATGACAATG
GTCGTGACGACGGCGCGTAGATGGACGCGTTGCACAAGTACGTGGCCTTTTACCAGCTTCCCGTGCGCGAAGAGTACACGAAGGACGATCTGGCATCGCT
CGTTGCGCGGTAGACAGTTGATGGCGACGTCATCGAGAGGATTGACGGTGGCTCCATATATAGGCACTTTGACTGCTCGCTCGAGGTCGAAGAGGACGAA
TCGATCCTGTCGTTCGTTACACGCGTCCGCAACGGCGAAAAGGCCAGCCGAACACAGCGCCAAGCGACGGACAAGAAGGTCAAAGCGGAAGCTGCCGCGG
CAAAGGAAGCCAAGAAGGCGGCGCAGCAAGCGTCCAAGCCGGCGGCCGCATCGTCGAGCAACAAGCGGCCGCGGCCCGACGAGGCCGATGCGCATGACGA
GCCAGAGAAGGAATCCAAGGACGACGTTGCGCCGCCGCCGGCCAAGGCGCCCAAGCCCAAGGGCGGCAAGTCGTCCAAGAAGGAAGAAGACAACGAGCTC
TACTGCGTATGTAACCTCCCGAGCTATGGCAACATGATTGCTTGCGACGGCGACAAGTGCCCGAACCCCGCGCAGTGGTATCACTTGGAATGCGTCGGCA
TCTCGGACGGCCAGCAGCCCGACACATGGTATTACAGCTCACTGCGGGCGTGTGGCTCACGCGACAATTAGGATGTGCCCCGAGTGCGACCCGAAGGCGT
TCGCGGCAGTGCTCAAGAAGAAGAAGAAGGCGCGCAAGATGCAGCAACAGTCAGGGTCCTCCTCGAGCTCGAGCTCGTCTCGCCGATAAGGGGTTACCTG
CGCTCGACCCTTGCAATTACAAAAGGAACACCCTACTCTCCGTTGCATACCGTAAACAAATACAATGCTACACGCCCTTCTTCTTCTTCTTCTTGGCGTC
GACGGCTGTGGTCTCGTGCAACAACCCAAGCGCTGCGTGCAGGAAGACTTGCTCAAAGGCCGCGGATTGAAGCTGGTCGAGGCGCCCGCCGCCGCCAAAA
TGACCGCCGTCTTCGCTGACGCGGAGCCAAATGTGGTCTGTCGGCGTCGCCGTGTTCTTGGCCCGAATCGCGTGCACGAGCTTGATGGGCTCCCAGTACT
GCACGCGCATATCGTTCATCGAAGAGGTCAGGAGCATGCGCGGGTATGTCGTGTGGCGCTGGACGTTGTTCGTTGGCGCATACGAGCGCATGTAGTCTCG
GACGACCAAGTCCTTCGGACAGCCCCACTCGTCGTACTCGTGGATCGTCAGCGGCAGCGACTCGTCGAGCATCGTGTCGAGAATATCCACAAAGGGTACA
TTGAGCACGAGGGCGCGGAAGAGGGTCGGGTATTCGTTCGCCATGTACCTACAACAAGCATCGATGCAGTGTCATGGACAAAGTGCTGCACCCCATGATG
AGGCCACCGGCCGACGTGCCTTTGCCCGCGAGCTTGGCTGACGAAGTGATCCCGTGCGTCAAGAGGTACGTGGCGCATGCATGGTAGTCGATGAACGTAT
TCTTCTTGGCGAGCTGTCGCCCGTTGGCGTGCCACTGGAGACCGAGCTCGCCGCCGCCGCGGACATGGGCAAAGGCGAGGACCCA