Description :
From Genome Similarity Track
Location :
Scaffold_894:1190- 2547
Transcript NameFunction/comments
g17139.t1POM80506.1 Reverse transcriptase, partial [Phytophthora palmivora var. palmivora

Sequence
1357 bases(100 bases per row)
TTGTATTCATTTTGATTGTGTAGGAACAACTCATCAGGTGGAGTCCGGTCTTCCGAAGACAAACGACACCTATAGGGATTACACAAGGTCACACGCCAAG
CTACTTCCGGAGGTCCCGTACTTTTGGAGGTAGTCTGACCCCATTGGGCTTTCCGAAAGGCGAAGTTTAAGCTTCCTGATCGGCCGAGTCTTCTGGCGCG
CGTGCGCTATACACCCTGGACGATAAAGGCGTTCACCCGCCTCGCCTCAGCTGGTGCGCGTGCCCGGATTTGGACGTCTAGTGATTTCACCGAGTTGTTC
TTATATTATTGATTGAGTTCTAGGGGACTGGGTGCTAACTAATCTTCTAACCGTGGTTATTATGGCTGGAATTGAAAGCACATGCGAAGGTGGACGTGAG
GGATCCGAACGCGGCGATGCGTCCCGGTCATCACGTCGAGTACAAGGGCTGCCTCCGGAGGAGCAGGCGACTTTGGATGAGGTCGTCAGGAATGCTCGGA
AGGCGAACGCTGCGAAGCGCAAGGCTGCCCAAGAAGCGAAGGAGTCGACGGCCCAAGAAGAAGACACTTCTGGATCCGCCGTTCAGGAGGCGCACCAAGC
GAATCAGGACGGTGATGTGGAGGTGCTTTCGGATGGGGAAGAAGACTCCGAGTGGTCTGGATCGGAATCTGGTTCGGATGACGAAAATGATTCCAGCTCG
CAAGAGTCTGATGAGGCGTCTGAGGGAGACGTCGTGAAGGTTGAGCCCCCGGCAGAAGATCGAGTTTCGGACTCTCTTCAGCCGGAAGAAGAAGTTGAAA
TTCTGGATGACATCAAGACATCCGAACGAGCGCAAACGATCAAAGATGAGCGGCCATTATCGACTGTTCAAGAAGATTCTGTGCTAGAAGATGTGGAGAT
GTCTTTGCCTGTGCGATCGGATGTCCCATTGCAGATGGAGCTTCCAGATGTCGTGTCGATGCAGCCCCCTCCAACCGCTATGCAGAAGGATTACCATCCT
GAAGTTCAAGAAGTGGAGACTGGGACGGCCGACGTTCAAATAACGGAGGCCCAGGCAAAAGCGTATGTGGCAGATCAAGTTCGACGTTGGGAACGTGATG
TTTCTGAAAAGAATGTCCCTCCGGATGTCAAGTATGATTGGCCGCAAGTGCGTTTGGATTCCGAATCGTTTATGGTTGCTAGTCTGACTACTTCGGATTA
CCTGAGACGACGGATGTCGATGCCGACTCAAGCGGACGCCTGGATTGCGGAGATGCAGTTACGACGTCGCACGTTTGGAATGGCCCGAGATCTGACCGCC
GCTCTGATTCCTCCTGGAATGTTCACACCCCGGGATTGCGTTGCTGTCTTGCAGACC