Description :
From Genome Similarity Track
Location :
Scaffold_244:1190- 2491
Sequence
1301 bases(100 bases per row)
CGCTTCCTCGTTGCACAAGCGTGTGTGCCGTGTATTGGGAACTGTTGTGAACAGCGTCCCATTACACCTGGTAGCACTTCGAGCGGTCCTTCCAACGACC
CAGTGAAGTGAAAGGTTTGACGACGCGGCTTTAAGCACGTCGCGCATTCCTGTTCAAGACCTACTCTTACCCATGTCCGGGAACATGGAAGGAGTTGATG
TGCCACTCGGTTCAGCAGTACCGCAAACTGTCGAGTTGACGAATGAGTATTTTCCTCATTTGTCTTCTCATGAGTGGTCAGCGCTGGAGCGGATGAGAGA
TGTCATCGGGGAGGCTGCTGTGGTCAGCCTGCTTCGATCGGCATCTCCTGAAGACCAAAAGAGCGCTGCGGTCAGTTTCATGCACCACGAGATTGTTGAT
CTCGAAAGCAGGTCGCAACCCTGTTTCGTCTTCAAGACGGCGCCTCTGAAGCTGAACGTGTCTCCGTATCGCGACGGAGAGAACGAGCTCTTTCGAGATG
GTTCGTTGAGTTGGATGCAGCAATGTCTGCAAGACAACTCCGTGACCCCTCGCAGCAAGTGTTGTTCGCAATGTCCAACCTTGCGGGTCGTGCGAAGAGC
TGGGCTTATGGGAAGCGTTTGGCCGATCCAAACTGCTTCTATAGCTACGACAATTTCAAGGCAGAACTCAAGATGGCGTTTGAACCACCGCAGAGTGAGT
TCCGTGCACGCGCCGAGTTTCTCAAGCTTCGCCAAGGTCGTTTCGATCTACACTCATATGCTCAGCGAGCTCGTTATCTGGTCTCGAGCATTGTGGACGA
GCCGATTGACGTCCCAACGCAAGTTGTGACGTTCATGACGGGTCTGAACGACGGTCCAATCCGGAACCAATTGTTCCGTGAGTACCCAAAGACCCTTGAA
GAAGCCATCAGCCGTGCGATGCAAGAAGAGTTTAGCATCAAACAAGCCAAGTTCCAAGGTTTTCCGTCAAGACCACCAAGGCAATCGAACGTCGTTCATG
ATGGTCCAGAGCCAATGGACATCTCGTACATTTCCACTCCTGGAAATGAACGTCCTCACAACGATGGAAAGTGCTTCCGTTGTGGGAAGTCGGGCCACTT
CGCTCGAAACTGCAAAGTGTCTTTGCCTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGGCCGTAGTAATGGTCGTCGGTTCGATCGTTCC
CAAAGGTCAAAAAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGGATGTTGTGAAACACAGGACTCTGGCCCCAAT
G