Description :
From Genome Similarity Track
Location :
Scaffold_2339:1190- 2445
Sequence
1255 bases(100 bases per row)
ATGGATCATATCTCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATTTGTTTACCGGATACGTGATAGCCAAAGCTAGTG
CGTCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTT
TATGTCTGATTTCTTTCGAGCATTCAACCAGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATG
GTGCAGACAATCACGAGAGCCTCAGAGATTATTTTCCCAGGTTTTTGTTCCAGAAGATTTGGAGGGAGTATTCCGCAGAGCGTCTTCTCCTTCGCAATGA
ACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTTTGCAGCAC
CAAGAAGAGGAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATA
CAGGATCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACG
CCCGCAAATCGGCCAAACTATGGCATGGACCGTTCCGGGTGAGCGAGAAGACTGGAGAACATGCGGTTAAGCTGGAAACGGCAGGTACCGAATATCGCCT
GTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGACTATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGTATCCGACCGCGTCGACTTC
GACGAAGTCCTCCTACCGTAAGAGAGTTGGAATGTGGATCTCGAAGCCGACGAGGTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGCGAACTA
GATACGGACGGATTTACCGTGAATTTCTGGTGTATTGGCGTAAATATGACGAACTCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTA
TGATTTCTTGCGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGACCCATGGATGTGAGTTGGTCATGTC
GATAAGAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGGAG