Description :
From Genome Similarity Track
Location :
Scaffold_735:119- 4920
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_735-snap-gene-0.4Voltage-gated Ion Channel (VIC) Superfamily

Sequence
4801 bases(100 bases per row)
GAATGCTGTGGATTCTTCTCCTCCAGCTTGTACTCTGCTACAACTGGGTCACAATTCCGTTACGCCTCGCATTTCCATTGTTCGATCGACCgCGTTGGTA
CATTGACGTTCTAAATGCCAGTACAGACGTCATCTTATGGATCGATGTCTACGCGAATTTGAACCTATCGTTTACAATCAACTCCGAGAcGATATTTGAC
ACAAGTAGAAGCGCTCTCAGGTATCTTAAGAGCGGGCATTTTGTCGCTGACgTCGCATTCTCGTTTCCGTACTCCTGGGTCGTTGAAAaTCTCGTTATTC
CAAAGCTATCCCCGAATGCAGTTTGGTCAATCACCCATGGGGTACTCCGCGTGCCACGATTACTTCGAGTCTGGAGAGTTGCTGGTCACTTACGCGAAGT
TGAAGAATATCTTGTTTTGAAGAGTAAACAAAGACTCTTGTTCTTTGGCTTGCTTCTGATCATGTTGTATCATATCGTCGCTTGTCTTCACTTCAGTATA
ACGTACTGGGAAGGATTCAGTGCTAAGGAAGATGCGTGGATTCCATCAGACGATATTTATCTGCACCAAGTGAATGAAACAACGTACGTTGATATTCAGG
GTAGATTCTACGATGCAGAAGGCGAACATGTTGCGATCATTCAGGCTCGACAGTACTTTCGATCTCTATACTACGCGTCGAACGTACTAGCAGCGCTTGG
TAAGACAATGGAACCAAGTAGCGATCGGcAATATGGCGTcGCCTTGCTCTTTATGCTCAGTGGGTTCTTGATCACTGCGATTGTGGTCGACAACGtCcAG
AAAAGATTCACGGCGTCGGCGTTGGAACAAAAAGAGTTTTTTGCTACACGAGCTCGCATTCAGCTTTTCTTGAAGCGCCAGAATGCTCCCCTTATAATCC
ATCAGCGTGTGAACTCATTCCTCGACTACTGGTGGTCGACTCACCGTGGGGCCGTCATTGAAGAGTTGTTACAGGAGCTACCGGAAATGATCAAACGCGA
CATTATTCGGAGCATTTGCAAACCGGCGATCGAGTCGATAGGTATGCTCTTTCCTCAGCTTTGGACAGAAGAGCACGGGCGCACAGAACTGAACACGATC
CGAAtCcAAACAGAGGAGATCTTTATTGACAATCTCAAGTTCATCCTGTATGGGCAAGGAGAAGTTATTTATCGTcAGGGTGACTATGCCAGTGGTCTCT
ACTTCCTCTTGGAAGGTCAAGTCTGCATTGAAAGCACAcgTGAACCTCCAAGGCGTATCCCGATCGGCGGGTATTTTGGAACTGCAGCTCTCGATTTGCC
TCAGGAGAATAGTCcTGCTGGAAtATCCCAAGCCCATTTCGAGCAGGTGACTGCACAAAGTGGCAGTATCGTTGTCTATGTgTCACGCGAACATCTGATG
ATGATGCAATCGATATTCCCATCGTTCTCAACATCTCTTCGATCCATGGAGAAGCGTGTCCTGGTGACTCTACAGGTAACTCGAGCCGCAGAAATGGAAG
CAGtCGTAACCAAGACCGTCCGTCTTAGTTCCCCtATAGGTAGGATGCCTCAAGCACACTCAgACCAAGATCGGCTTTTGCAGTTTATGAAAGCAACGAG
CGTATGGAAGTATACTACAGGTGAAGAGTGCTTTGATCCCGACACTACCTTCATTGTGTTCTGGGAGGTATGGGTCTTTGCAGCGATGACAATTCAGGCT
GCGTTAGTCATTTTTCATGTTTGCTTCGGCGTaGAGCCAaCGCGAAGCGTCGCAAGCGGTGAAAACCCTTCTCAAGCAGTGGTCGCGGCAGATGTAAtAA
TGTTGTTATTGGAGTCATGTTTCCTGGTTGATTTATTCATTCGGACGCGCTTGGGATTTTACGAGTATGGGAACAAGGTCATGAGCTTGCGTCAGATTAA
GTCGCACTATATTGGCTCGAAGTACTTCGTAATCGATGTCGCTGCACTTTTACCTTTTTTtCTAATCAATATTGGAAAATCACGCAATCGATATGAGCTG
GTGAACATGAATAAGCTGCTGCGGTTGTTCAAGTCACCAAGTCAGTTTCGCGATCTCGAAGCGAAACATGCCAAGTTGACCATGGAGCTACGGCTTATAC
GTCTTGTATATTACTCGTTCCTGGCTTCCCACACTTTTGGTTGCATTTGGTTTGACTTCGCCGCACACTCATCAGGAATTGGTGGTACTTTATCGACGAC
AAGCTTTGGAGACAACAAATGGTTGCCGTACGCTTCTCTCAAatcTTCAGATCGAAGTCTGCagTACTTTGCCTCCGTATTTTGGGCGTTTGGAATCATG
ACAGCATCCACAACTGGAGAACTTCCGAAGACCGTGTCgCAGTGCCTGTTCACTGTGATCACCATGACGACGGGCTTCTTTTtATTTGgaTATGTGGTTG
GTAATTTCTTGGATGTGATCGAACTTCAAGATTCTGAAAATCGTCATTTCATCGCCAAATTAAGCTCTTTGAGGCATTTACTAGGCCACTTTCGCCTCCC
GCACAGTATCGAGGAGAAGTTCAAAACATTTTTCTTTTTCAAGCGATTTCACTCGATTACCCAGGAGCACGTTTTGGAGCGCGTTTTGCCCCCcTCACTT
CTGGTCGATATTCGCATGTTTCAGCTACAGCCGATGATAGTGAAAGTTGCATTTCTAGCGGGAATGGAGGACTCAGTCACGCGTATGCTTGTTTCTCTTT
TCACGCAACAGTTAGTCGTGAAGGACATGTTCATATGCAAATTCGGTGAGGAAGGAAAGGATATGTTTTTcATTTTCACTGGTGTTCTCGACATCTATGT
TCCACTTCCTCCAGGTGCAGCTCACGGCGGCTCCACCACCTCTATAAACGAGAATGCCACcGGTAAAACTGGTGTGACAGGagATTTTGAGGCTGACGAG
ATGATTGGCTTTCATAAAGTCAACCAAaTCACAGCAGGAAGCTACTTCGGGGAAGCGGCACTcTTCACTCGAGCCCCTCGTAACGCTCATGTGAAAGCTC
GTACTTCCTGTATCCTGTATCGCCTTTCCCGAGAATCTCTGGAGCTTGTCTTCGACAGATTTCATGAATGGAAGCTGAAGGTCTTGCGGATTGTGAAGAT
CCAACAGGAACAGCAAAGGCTCATGCGTCTTGCCGCCGAAGCACAGGAgTCTAATGGATCTGGGACCTCTTCAGGAGTCAAGCGCCGCTCACTCAAACGG
ACAATGTCACGGCTGGACTTGATCAACTCGCGTGCTCAAGACATGGAAGAGCTCGTTTtAGCGAATACGCGGGGTGGTCGAGGGAGCAAGTTTtCTCCTG
CAGAGTGGATTGTCAAACGCGCGAAAtcGGTGCAATTAGTGCAGCGTTATGTGAAGCCCTGGATTGCAAATACTCGTCACTGGGTTGAACTGCTGACAAG
AGGAACGGAGGTACAAAGCCCATTCTATATTTTCTGGCTTCGACTCGTTACGTTGTGCACAGTCTACGTCGCGCTTATTACTCCaTATCGGTGTGCATAC
GACTCTTTAGACAGATGGACGGTGTTTCCAACGGTTTTCCGGGTTCTTGAGGGCATGTCAGACATCATCTTCTGGTGGGATATCTGGTTTCATTTTCGAG
TTCGAGAGAGTCTCGGTGCCATGGAATTGTATGAACAAGACCACCTGCAGGCCTaCAAACGAGAGAGGCTTCTgTGGGACGCGCTAGCTGCcTTCCCCcT
CGATCATTTACTCGAGGATCAATtcTTtGGTTCCATTCGTTCAAGAATCCaGAAATGGTGTCGCTTGAACCGATGTTTGAAAGTAGCAAATCTTGCGTAC
TATCGTCTTGAAGTCAATCGACGCAGTGTGACGTACGAGCTCAACCGCTTCGTGACTATATGGATGGTCTATCTGCTCGTGATTTATTGGACTTCATGCG
CATATTTTGCTGTTGCGATGCATGACGGATTCGGGGATGAGTGGCAGGCATGGTTGCCGTCGAAACAGCTTTACAATACGGATGACTCGGAAATTTTACT
TCTTCGCGTGTTTCGAGGGATGGCATTTGCAGTCACTGCGTTTGTTAAAAAAGCACGCACCTTCACACCAACACGAACTCTGGACTACGTGTTCAGTATC
GTGATTAGTTTtGTTGGGCAACTCAGCATGGCGTTGATGATTGGCGAGATTGCTAGTATTTTCATACTCTACATTGACAACGAAGTCGAGTTTCGGAAAA
ATCATATCGCATTGGAgTTGTTCCTCTCGCGGAAGAGTCTCAGTCATCCCCTCAAATCGCGCTGTGCATCTTTCTTGACCTCTTGGTGGTCATCGCATGC
CGGTGTCAACTATCAAtttATCTTCGATGACCTTCcTTtAACCGTGCGAACAGAAGGAGTCATGTACATCGCCGAGAAGCCACTTACACGGTTCATGGAC
CaCGTTTTCCGTCCATTAACGCGTGGctATGGAGTTCAGGTGGATAACGACGAGGAAACAGCAGACCTGGCCGCTCAAGGCGAcgCTGCCGTTGAGAGCT
TGATGTATGCTATAGCACAGCATCTACACTTTGAAGGATATCCACGAGGTGAGGATGTGATCGTCGAGGGAACAGTCTGTCCTGCCGTGTTCTTCGTCGT
GAAGGGCTACCTCTACTCGAAGAGTGTTTCGAACCCAAGTCTCTATCATGCTGGACGCTTCCGGATGGGTGACTACTTCGGCGAGAAAGGATTACTTGGC
CACTCTGTCAGCCTCTTTACGGTCACAACTGTGCGTGCCTGCGACCTATTTGTTCTTCGCTCTGAACGCCTCGTTGATGCCATCCAGTCGCATCGCTATT
T