Description :
From Genome Similarity Track
Location :
Scaffold_2478:119- 2948
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2478-fgenesh-gene-0.2Conserved gene of unknown function
Pytar_ATCC12531snap_masked-par_contig_2478-abinit-gene-0.6Conserved gene of unknown function

Sequence
2829 bases(100 bases per row)
CCTGGAGCTGCGCTTTCATGCTGTCGGCAAATTGCTTGGCGCGCACCTTGAGTTCGTTCTCATGGGCTGAGATCGTGGCGATCTCCTTCTTCAGTCTCTC
CACGTCTTCGGTCGCTCCACCGCCAGACCCACTGGCGTCCTTTGCGAGCTTGAGTTGGCCCTCCAGCTCGCTCACTTTCTTCTTCTCCCCCGCGAGTTCA
TTGCGCAGGTTGTCAACAAACGACTTGGTCTTGAGCTTGAGCTGGTTGAGCGTCTCGTCCTTGGCGTGCACTTCGTTGCGCAGACGCGTGATCTCTTGCT
GCGCGTCCATCGTGGGCGTCCTCTCTCCTTCTCTTCAATGACCCGTGGCGTTTGGTCGGAACATCGAGCTCTCCAACTCTGAAGCCATCGCCCAGCAACC
TTCCCAGTGTGACACGCAGCCCAGTCCTCCATCCAATAGACACGGCTATGTTTGGCCACGCCAGGGTCGTTCTGGTCGGAAGAGAAGGCCATGCAAACCG
TCTCGATATAGCCCCACAGATGCACTGTCCCATTGCCGCCNNNNNNNNNNAGGGTCGTTCTGGTCCGAAGAGAAGGCCATGCAAACCGCCTCGATATAGC
CCCACCGATGCACTGTCCCATTGCCGCCACACTACCTCTCGGACGCGGATCGATCTGCAACGGATCCCCTCCCACATGGTGATCCCCTCGGTGAGATCTT
AGTTACCCCGACTTCAACTTTGTCACTNNNNNNNNNNAACGCACGCGGATCGATCTGCGACGGATCGCCTCCCACATGGTGATCCCTTCGTGAGATCTTA
GTTGCTGTTCCCCGACTTCAACTTTGTCACTNNNNNNNNNNTAACCGTCCGCTCCTCCGCTGCACTACTATTACCGACAGAATAATATTTGGCTGTGGGT
GGATATGTCGTCCACGGTACGCTCCGTCCGCCCATCCGTTCTCCGGTGCGTCCGCTAAGCGAATACACTGGGGGCCCATTCCTCCCCCTTGGTCGTCCGC
CCAGAAAGGGAAACAAGGCGTACGGTCTCCTCTCCTCTCCGCCAAGCACTGTAGCTCCTCCTCTCGTCATTAGGCGCGTCCGGGCGTGCGGGTGATCTCC
ACTCGTCCATCTTATTTCGCCCGTCCCTTTCCTTCTTATTCGTAGGAGTGCGTGTGCGTGAGTGTGCGAGTGGCGTGCCTTCCGTCCCTCCCGCCTCTCG
CCTCTCGCCTCTCGCCGCGACGACCATCACGACGTATTCGAAAGGCTCGACCACGATTCTCGCCGCGTACGTCGACGTGATCGAGCGCATGATCATGGAC
TCGGGGCTCCACCACGCGAGCGTGCTGCCCGTCGGCGTCGGCGTCGGCGTCGGCGTCGTCGACGTCCACGGCAACAGCAGCGGCGACATTGACTCGCTGC
TCAGCAGCAGCGACGCGCCCGACCACGTCGCGGGCAACGGCAGCGACAACGGCAAGCCGCGCCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCGAACGCCAACGACAACAAGAATGGCTACATTGTACTGCTGCGAAAGTTTGACGGCACGTCGCCGT
CGGCGAACGGCCTGTCGCCTGATGACCGCAGTAGTCTGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCACGGCCACTCGCACAGCGGCGGCGAGAACGAGGACGATACCGACGAGAACGATGCGCTCGATGGAAGCGGCCACATGGGCTCGCTCGTC
AAGAAGCGCAAGCTCCCGTCGTCTCAGCAGCAGCATCTCCAGCAGCAGCCCCACGGCAACGGCACGGCCAGCTTGACCCACGCTGCTGTCGCAGCAGCGG
CCGCGGCGGCGAATGACCTCGCCGGGTTCTACGACACTACGTCGACCCCGCTCGTGCCCGTGCTGCCGATGCAGTACCCGAACCTGGTCAAGCCGCCCAG
CGCGAACGCGACGGCGACGGCGTCCGACCTCGAGATTCTCAGCGGCATTGCCAACACGTACACGACGCAGCCGGGCACGACGGCCTCCGGGTCCACCACT
CAGGCCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCATGTTTTGCGGCAACTGCCGCACGATCGTGACGGACCAGCTCATGGAATCGA
TCCGCTTGGGCCGCAACAAGATGCAGATGATCGAGTTCCAGCGGCTCATGGACCAGCGCGACCGCGACACGATCCATTTGAAGGAGACCATTACCGTTCT
GCGTGATTTGCGTCGCTCGCTGCGAGACGCGCAGAACGAGAACCGCTTGACCCACGAGTTGCTGGTCGAGTACGAGGACGACATAGCGTTCTTCCAGAAC
CTCAAGGAACGCACGAAGGACCGCATGCGCAAGGAGATGCAGGAGCGCGCGGCTAAGCAGGCCAACGCAGGCAACGTGGGCACCACCTGAGGCCGACTGC
TTGCGGTGCAGCGACAACGATCGAGCTACCGCGAGGGAGACAGTCGGCGAGGAGGAGGAGGAAGAGGAGGAGGATGTGAAAAGTGGCAGCAGCAGTGGTG
GCGGCGGCAGTGGTGGCGGTGGCGGTGGCGATAGCGACGGGCAATCGCGACGGACAAATCAAATTTCATTTCAAGGACAAACAACGGGTGATAAGGTAGG
GCAGATGGGAAGGCGACTACCGCAATATGTAGATAGGGAACGAGGGTTTCATCCCGAGGGAAGAACGTTTTGCCATGTGGAAGCTAGAACAAGCGAGCGG
ACGAAGCATGAAAACCCACTCCTCTCGAC