Description :
From Genome Similarity Track
Location :
scaffold_775:119- 1560
Transcript NameFunction/comments
Pl_102469conserved hypothetical protein

Sequence
1441 bases(100 bases per row)
CGCAGCGTTCCATTCACCATCTAACCTAGATGAATTAAGACTGCTTTCAGCCGAAAAACAAGAAGATTTTCAGACGCTGACAGCATTCATCACCTACTAG
ACGGAAACCACCGCAATCTAGTAGTAGGTTCTGCGTGGCGATTAGGAGTTCAGTCATGTTGGCCCTGTCCACAGCAGACTCCGAGAGCCCTACCTTCTTG
CAAGTTGCTACGCGAGCCTCGCCGAACTGATCATTGATGTATGCAGAAAACGCGAGCTTCTCTTCCACTGACCACCGAGTGAAGACGCTGGAGCGCATTC
TGGGCTCTGGGATATGGTTATTGCCAAGATGTAGACTACCCACACCACGAGTAGCTCCGTCAGATACGTCCTCGTCCTCGTCACTGCCACGTTCATATCG
ATGTGGTTCGATGGACCGCCGCTGCATCCGTGCCCGACGACGCACATGAGACTTGTAAGCTTCTGTGTGGCCTACCAACCGATCTACCAGTTCATCCAGC
GCACGGTTACGAACGGGAACAGTCTTCACTACATCGCGGCATTCTGGACACGACAGTGACTGGCGGAACCAGTTACTGATGCAGTATCCGCAGAACGTAT
GGGAACATGGCAGCGTTGCACTGCCATGAAAGTACTCCAGACACACTGGACACATCATTAGTCGTTCGCGCTCTTCTTTTTCCTGCTCCCGGACTCTTTT
AGCGGTACTGTTGTCTCCTTCAATAGCTGCTGCTTCTTCCTCAATAACACCGCCTCGACGTGAACGTTTTCTCTGCTGGCTATTTGGCGTATCATCTTGT
TTGTTCTTCTCCATATTTTCATTTTCAACTCTTGTTTTCCTCGGACTGCTACGACTTCGTTTCTGCGAAAGATTCTGTGGCGGAGGTGTCACCATGTTCA
TCTCACTGCGTGGTGTTCCCGCCAACGATCGACATCCTGTCCTCGTAAAAGCCGGGCTTCCTGCAATTGTCCCTGCTGATCTTCCAAAACCTGCAGCAGC
TACCGCATTGGTCATCACAACTCGTGGCGAGCGATGCGGAGACGACCCTGGCGTCGTTGCTTGACGGTGCAACGGAGCTGGTGAAGGTGTGGTCGAGCGT
GCCAACGCCTTCACTACAATGCGCGAGTGCGCATCATCCGGAAATTGAACTACGAGACGGACACATTGCCTCATGGCCGAGGCCAGCACTACCTCGTCAC
CATCGTGAAGCTCTTGGTTGCCTCCTTTGGGTATCTCCACTCCATTCACTGCCGTGCCGTTCATCGTCTCCAAGTCGTAAATGAGCCAGCGTCGCTTGCC
AGATCCTGACCGCGCCAGCGTCTCAGTGAGAGGGACGATACCTACATGGCGCTTACTTACAGTACGCGTCTCCTCGGACGTGGCGATGCTGACTTCGCAG
CCGCGACTACGGCCCACGCAGAACGAGGCAGAGAACTCCCA