Description :
From Genome Similarity Track
Location :
Scaffold_1380:119- 1307
Sequence
1188 bases(100 bases per row)
CACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGGCCTCATCTTGATCCTTGCCCGTGAACT
CCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGG
GCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCATGGAGCACTTGCACT
TGTGGCACGGGGCGCTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCAAAGTGCCGTTGCAGGGTGCCCGCGGAAGTGTCGGAAGAGCCT
GTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGAT
CCTGGCTGGATTGTGTCAAATCACGCGTAGGGTGTACTGGATCCCGAGCTTTCACGCTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAG
CATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGG
CTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGAT
CCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTT
CGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATACAGGAAGTCGCGTAAA
GCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTCGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCG
TAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGC